ID: 1135386288

View in Genome Browser
Species Human (GRCh38)
Location 16:22043914-22043936
Sequence GACTCACAGTTCCACGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135386285_1135386288 16 Left 1135386285 16:22043875-22043897 CCAAGACTGGGTAATTTATAAAG 0: 3429
1: 4465
2: 3325
3: 3035
4: 2495
Right 1135386288 16:22043914-22043936 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083
1135386284_1135386288 17 Left 1135386284 16:22043874-22043896 CCCAAGACTGGGTAATTTATAAA 0: 2548
1: 10465
2: 14335
3: 13164
4: 9470
Right 1135386288 16:22043914-22043936 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135386288 Original CRISPR GACTCACAGTTCCACGTGAC TGG Intronic
Too many off-targets to display for this crispr