ID: 1135387373

View in Genome Browser
Species Human (GRCh38)
Location 16:22055091-22055113
Sequence CTCAAAAACAAATGGAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135387373_1135387377 -8 Left 1135387373 16:22055091-22055113 CCTTCTCTCCATTTGTTTTTGAG No data
Right 1135387377 16:22055106-22055128 TTTTTGAGGGTCAACAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135387373 Original CRISPR CTCAAAAACAAATGGAGAGA AGG (reversed) Intronic
No off target data available for this crispr