ID: 1135392879

View in Genome Browser
Species Human (GRCh38)
Location 16:22108434-22108456
Sequence GGTGAAGTATGTAGGGCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135392874_1135392879 3 Left 1135392874 16:22108408-22108430 CCTTAGATGCATTTTAACTGGAA No data
Right 1135392879 16:22108434-22108456 GGTGAAGTATGTAGGGCTATGGG No data
1135392872_1135392879 17 Left 1135392872 16:22108394-22108416 CCATTGCTGGTTGGCCTTAGATG No data
Right 1135392879 16:22108434-22108456 GGTGAAGTATGTAGGGCTATGGG No data
1135392871_1135392879 23 Left 1135392871 16:22108388-22108410 CCTAGACCATTGCTGGTTGGCCT No data
Right 1135392879 16:22108434-22108456 GGTGAAGTATGTAGGGCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135392879 Original CRISPR GGTGAAGTATGTAGGGCTAT GGG Intronic
No off target data available for this crispr