ID: 1135396738

View in Genome Browser
Species Human (GRCh38)
Location 16:22137405-22137427
Sequence GTCTCATAATGGAAGGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135396732_1135396738 -2 Left 1135396732 16:22137384-22137406 CCCACAAGTGGAGGCCACAGTGT No data
Right 1135396738 16:22137405-22137427 GTCTCATAATGGAAGGGTGCTGG No data
1135396728_1135396738 22 Left 1135396728 16:22137360-22137382 CCTGGCATGCGGCAAGCTGACTG No data
Right 1135396738 16:22137405-22137427 GTCTCATAATGGAAGGGTGCTGG No data
1135396727_1135396738 23 Left 1135396727 16:22137359-22137381 CCCTGGCATGCGGCAAGCTGACT No data
Right 1135396738 16:22137405-22137427 GTCTCATAATGGAAGGGTGCTGG No data
1135396733_1135396738 -3 Left 1135396733 16:22137385-22137407 CCACAAGTGGAGGCCACAGTGTC No data
Right 1135396738 16:22137405-22137427 GTCTCATAATGGAAGGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135396738 Original CRISPR GTCTCATAATGGAAGGGTGC TGG Intronic
No off target data available for this crispr