ID: 1135400431

View in Genome Browser
Species Human (GRCh38)
Location 16:22162888-22162910
Sequence AGCCATGTCCAGGGTGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135400424_1135400431 18 Left 1135400424 16:22162847-22162869 CCATAGCCTGTACTTCACTGAAC No data
Right 1135400431 16:22162888-22162910 AGCCATGTCCAGGGTGGGTCTGG No data
1135400426_1135400431 -7 Left 1135400426 16:22162872-22162894 CCAAAAGAATGAGTGAAGCCATG No data
Right 1135400431 16:22162888-22162910 AGCCATGTCCAGGGTGGGTCTGG No data
1135400425_1135400431 12 Left 1135400425 16:22162853-22162875 CCTGTACTTCACTGAACTTCCAA No data
Right 1135400431 16:22162888-22162910 AGCCATGTCCAGGGTGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135400431 Original CRISPR AGCCATGTCCAGGGTGGGTC TGG Intergenic
No off target data available for this crispr