ID: 1135405197

View in Genome Browser
Species Human (GRCh38)
Location 16:22192562-22192584
Sequence CAGGGAGAAGAAAGAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135405197_1135405204 8 Left 1135405197 16:22192562-22192584 CCTTCCTCTCTTTCTTCTCCCTG No data
Right 1135405204 16:22192593-22192615 GGGAAATCTGTTCTTCGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135405197 Original CRISPR CAGGGAGAAGAAAGAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr