ID: 1135407049

View in Genome Browser
Species Human (GRCh38)
Location 16:22206269-22206291
Sequence GGTCTAGGTTGAGCAGAAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135407049_1135407056 13 Left 1135407049 16:22206269-22206291 CCCGCTTCTGCTCAACCTAGACC 0: 1
1: 0
2: 2
3: 16
4: 136
Right 1135407056 16:22206305-22206327 GCCTCAGCTCCCCTCCTTCCTGG 0: 1
1: 0
2: 5
3: 56
4: 599

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135407049 Original CRISPR GGTCTAGGTTGAGCAGAAGC GGG (reversed) Exonic
900095618 1:938959-938981 GGTCCAGGCTGAGCTGGAGCAGG + Intronic
901230061 1:7636783-7636805 GGTCTAGGGAGGGCACAAGCAGG + Intronic
901624215 1:10614519-10614541 TGTCAAGGCTGAGCAGACGCTGG - Intronic
902155725 1:14484652-14484674 AGTCTTGGATGAGCAGAACCAGG - Intergenic
902596150 1:17510704-17510726 GGTCTAGGTGGAACAGAAGTGGG - Intergenic
902705971 1:18204716-18204738 GATTTAGGTTGGGCAGGAGCAGG + Intronic
903218680 1:21856872-21856894 GGTCTAGGCTCTGCAGAAGCAGG - Intronic
903558574 1:24211016-24211038 GGTGTAGGTTGAGGAGCAGAGGG - Intergenic
904476564 1:30768953-30768975 GGCCTGGGATGAGCAGAAGCAGG + Intergenic
904843110 1:33386929-33386951 GTTCAAGGCTGAGCAGGAGCAGG - Intronic
905355601 1:37381829-37381851 TGACTAGGTTGAGCAGAGACTGG - Intergenic
905690740 1:39940950-39940972 AGTCTAGGATGAGAAGATGCTGG + Intergenic
907442312 1:54486758-54486780 GGCCTAGGAGGGGCAGAAGCTGG - Intergenic
907778012 1:57537885-57537907 GGTGGAGGGTGAACAGAAGCTGG + Intronic
910403354 1:86858657-86858679 GCTCTAGGATGTGCAGAAGTTGG + Intergenic
910979349 1:92943680-92943702 GCTCTAGGTTGAGCCTATGCTGG - Intronic
912475351 1:109931239-109931261 GGGCTAGGCTGGGCAGGAGCAGG - Intergenic
916289629 1:163150602-163150624 GGTGGAGGTTGAGGAGAAGAAGG + Intronic
916453857 1:164950018-164950040 TGTCTAGGCTGAGCAGAAGCAGG - Intergenic
920987054 1:210900838-210900860 TGGCTAGGTTGAGGAGAAGGAGG - Intronic
923499321 1:234551253-234551275 GGCCTCGGATGACCAGAAGCTGG - Intergenic
1063807729 10:9666401-9666423 AGTCTAGTGTGAGCAGAAGTCGG + Intergenic
1067723598 10:48749619-48749641 GGTGAAAGTGGAGCAGAAGCAGG + Intronic
1070304505 10:75232161-75232183 CTTCCAGGTTGAGAAGAAGCTGG + Intergenic
1070789487 10:79180901-79180923 ATTCTAGCTGGAGCAGAAGCTGG - Intronic
1073641378 10:105255740-105255762 GGTCCAGTTTGAGCTGAAGCCGG + Exonic
1077322348 11:1947924-1947946 GGTCTGGGCTGAGCAGAACCGGG - Intronic
1079790235 11:24728409-24728431 GGCCTAACTAGAGCAGAAGCAGG - Intronic
1080807124 11:35663357-35663379 GGTCAAGGTGGAGCAGGAGAGGG + Exonic
1082872227 11:57953833-57953855 CGCAGAGGTTGAGCAGAAGCAGG - Intergenic
1083961085 11:66015450-66015472 TGACAAGCTTGAGCAGAAGCAGG - Intergenic
1084064057 11:66693361-66693383 GCTCTAGGTGCAGCAGCAGCAGG - Exonic
1084717368 11:70882580-70882602 GGGCTAGTCTGTGCAGAAGCAGG + Intronic
1085521982 11:77144447-77144469 GGCCTGGGTGGAGGAGAAGCGGG - Intronic
1087255987 11:95954114-95954136 GGTCTCTGTTGAGCAGCAGATGG + Intergenic
1089286720 11:117412195-117412217 GGTCTGGGTGGAGGAGAGGCTGG - Exonic
1202805366 11_KI270721v1_random:3237-3259 GGTCTGGGCTGAGCAGAACCGGG - Intergenic
1092398878 12:8154212-8154234 TGTGGAGGGTGAGCAGAAGCAGG - Intronic
1095946819 12:47758515-47758537 GGTCAGGGTTGAGGAGGAGCAGG - Intronic
1096458393 12:51806613-51806635 GGTTTAGGATGGGCAGCAGCAGG - Exonic
1098407515 12:70141705-70141727 GGTGTAGGTGAAGCAGGAGCAGG + Intergenic
1101030974 12:100659848-100659870 GATGTGGGGTGAGCAGAAGCAGG + Intergenic
1104246882 12:127051654-127051676 GGACTGTGTTGAGCAGCAGCTGG + Intergenic
1105605632 13:21924345-21924367 GCTCCAGACTGAGCAGAAGCTGG + Intergenic
1106562086 13:30855635-30855657 TGTCAAGGTTGTGAAGAAGCTGG - Intergenic
1109242045 13:59901435-59901457 GGTAAGAGTTGAGCAGAAGCCGG - Intronic
1112869611 13:103953882-103953904 GCTTTAGGTTGAGCAGAACTGGG + Intergenic
1113848585 13:113405470-113405492 GGCCTAGGATGATCAGAAGCAGG + Intergenic
1119665016 14:76479296-76479318 GGTCCAGGCTGAGCAGACTCTGG - Intronic
1125158169 15:36613510-36613532 GATCCAGGTTGTGCAGCAGCAGG + Intronic
1127846821 15:62877601-62877623 GGCCTAAGGTGATCAGAAGCAGG + Intergenic
1128762372 15:70226109-70226131 GGTCTAGGTAGACAAGAAGGAGG + Intergenic
1129302842 15:74636022-74636044 GATGTAGTTTGAGCATAAGCAGG - Intronic
1129669285 15:77598248-77598270 AGTCTTTATTGAGCAGAAGCAGG + Intergenic
1129866158 15:78910275-78910297 GGTCTGGGATGCGCTGAAGCAGG - Intergenic
1133719773 16:8484070-8484092 GCTCTTGGCTGAGCAGAAGCTGG + Intergenic
1134018688 16:10906968-10906990 CGTCTAGGATGAGCAGAACGCGG - Exonic
1134620541 16:15685763-15685785 GTTCTAGGTGGAGGAGGAGCTGG + Intronic
1135407049 16:22206269-22206291 GGTCTAGGTTGAGCAGAAGCGGG - Exonic
1135972969 16:27085603-27085625 AGGCAAGGATGAGCAGAAGCAGG - Intergenic
1137843994 16:51669094-51669116 GGCTTGGGTTGAGCTGAAGCAGG - Intergenic
1137889682 16:52146062-52146084 TGTCTGGGTAGAGCAGAAGCTGG - Intergenic
1140633398 16:76881695-76881717 GTGCTAAGTTGAGAAGAAGCTGG - Intergenic
1140648993 16:77066207-77066229 GGTCTAGGCTGTTCAGAGGCAGG + Intergenic
1142867196 17:2798195-2798217 GGTCTAGGGTGAGCCGAAGGTGG + Intronic
1146523710 17:33547733-33547755 GGTGTAGCATGGGCAGAAGCTGG - Intronic
1147228763 17:39002041-39002063 GTTCTGGCTTGAACAGAAGCAGG - Intergenic
1148123939 17:45227382-45227404 GGTCTTAGGTGAGCAGATGCTGG + Intronic
1148904842 17:50905449-50905471 AGTCCAGGGTGAGCAGAATCAGG - Intergenic
1152684461 17:81687288-81687310 GGTCAGGGTTTAGCAGGAGCCGG + Intronic
1157547286 18:48555398-48555420 GGTCAAGGGTGTTCAGAAGCTGG + Intronic
1157996605 18:52565029-52565051 GGTCTTGCTTGGGAAGAAGCTGG + Intronic
1161246647 19:3256276-3256298 GGTCAGGGATGAGCAGAAGGAGG - Intronic
1162199682 19:9011112-9011134 GGCCTGGGGTGAGAAGAAGCTGG - Intergenic
1163435877 19:17294731-17294753 GTTGAAGATTGAGCAGAAGCTGG + Exonic
1163795290 19:19334455-19334477 GGGCAAGGGTGAGCAGCAGCTGG - Intronic
1164760965 19:30727959-30727981 GGGCTGGGTTGAGTGGAAGCAGG + Intergenic
925015832 2:523570-523592 GATCAAGGCTGAGCAGAGGCCGG + Intergenic
925216524 2:2100740-2100762 TGGCTTGGTTGAGAAGAAGCAGG - Intronic
925867151 2:8238333-8238355 GGTCTAGGTTGCACAGCTGCTGG - Intergenic
926384330 2:12321312-12321334 TGTCTGGGTTGCGGAGAAGCTGG - Intergenic
928055638 2:28051487-28051509 GGTCAAGGTGGAAAAGAAGCAGG + Intronic
928141864 2:28736296-28736318 GGGCTATGTTTAGCAGAAACTGG - Intergenic
937668641 2:124515708-124515730 CGTATAGGTGGAGCAGAGGCTGG + Intronic
938613226 2:132970872-132970894 GGTATAGACTGAGCAGCAGCTGG - Intronic
941921095 2:170851584-170851606 GCTCTAGGGAGAGCAGAGGCAGG + Intronic
945323294 2:208452525-208452547 GCTCTAGCTTCAGCAGAACCAGG - Intronic
946733412 2:222730796-222730818 TGTCTTTGTTGAGCTGAAGCTGG + Intergenic
947085966 2:226453767-226453789 TGTGGAGGGTGAGCAGAAGCAGG + Intergenic
1169240757 20:3977930-3977952 ACTCTAGGATGAGGAGAAGCTGG + Intronic
1170485386 20:16810467-16810489 TGTCTTTGGTGAGCAGAAGCTGG + Intergenic
1171896894 20:30816075-30816097 GGTCAAGGGGGAGCAGAGGCGGG + Intergenic
1174302128 20:49590000-49590022 GGACTTGGTTGATAAGAAGCTGG - Intergenic
1175203003 20:57290852-57290874 GGGCCAGGTGGAGCAGCAGCAGG - Intergenic
1175287181 20:57844752-57844774 GGTCTGGGGTGAGCTGGAGCAGG + Intergenic
1175738817 20:61406295-61406317 GGTCCAGGCAGAGCAGATGCTGG - Intronic
1178723259 21:35028833-35028855 GGTCTAGGATCAGAAGAAGCTGG + Intronic
1180073531 21:45450399-45450421 GGCCTAGGGTGGCCAGAAGCAGG + Intronic
1182445221 22:30386087-30386109 GGTTCAGGATGAGAAGAAGCAGG + Exonic
1182760459 22:32718285-32718307 GGACTTGGTGGAGCAGAATCTGG - Intronic
1183931597 22:41238717-41238739 AGGCCAGGTTGAGCAGGAGCAGG + Exonic
1184331920 22:43832902-43832924 GGTTTAGGTTGAGTAGCAGTGGG - Intronic
1184454406 22:44600989-44601011 GGTCAGGGTTGAGCTGACGCAGG - Intergenic
949537892 3:5009985-5010007 GGTCCAGGGAGAGCAGAACCAGG + Intergenic
950075027 3:10181005-10181027 GGTCCAGCCTGTGCAGAAGCAGG - Intronic
951040730 3:17986531-17986553 GGACAAGTTTGAGCAGAATCTGG + Intronic
951194052 3:19804243-19804265 GGTGTGGGTTGAGGAGATGCAGG - Intergenic
952611622 3:35216669-35216691 GGTCTAGGAGAAGCTGAAGCTGG - Intergenic
952906430 3:38141947-38141969 GCTGAAGGTTGGGCAGAAGCTGG - Exonic
956853910 3:73257312-73257334 GGAGTAGGTTGAGCAGAGTCTGG - Intergenic
958049296 3:88323903-88323925 GGTAGAGGTGAAGCAGAAGCAGG - Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
965693231 3:171380103-171380125 GGACCAGGTTGAGCAGGGGCTGG - Intronic
966337054 3:178880094-178880116 GGTCTGGCTTGAGTTGAAGCTGG - Intergenic
967080341 3:186043904-186043926 AGACTATGTTGACCAGAAGCTGG - Intergenic
968233758 3:197019301-197019323 GTTCTTGGCTGAGGAGAAGCGGG - Intronic
968335169 3:197907408-197907430 GGTTTAGCTTGAGCAGCAGGAGG - Intronic
973538162 4:51905711-51905733 GTTCAAGGTTGTGCAGAGGCTGG + Intronic
984175117 4:176407867-176407889 GGTCTGAGTTCAGCAGAGGCTGG - Intergenic
987309714 5:16670681-16670703 GGTCGAGGAGGAGCAGATGCTGG - Exonic
990727361 5:58771104-58771126 GATCTTGGTAGAGCAGGAGCTGG - Intronic
993685777 5:90935422-90935444 GGTCTAGGAGGTGCGGAAGCTGG - Intronic
1002976191 6:2080075-2080097 AGTCTAGATTAAGCAGAAGAAGG - Intronic
1006338743 6:33434178-33434200 GGACAAGTTTTAGCAGAAGCAGG - Intronic
1007394196 6:41568192-41568214 GGTTGAGGTTGAGAAGGAGCAGG - Intronic
1011031236 6:82925700-82925722 TGGCTAGTTTGAGCAGAAGCAGG - Intronic
1015790980 6:136964483-136964505 GGTCTAGGTGGGGCAGAAAATGG - Intergenic
1016612616 6:146009520-146009542 GGTCTAGATTTAGCATAAGCAGG - Intergenic
1018968575 6:168508666-168508688 GGTTGAGGTTCAGCAGAAGCTGG - Intronic
1019056181 6:169225160-169225182 GGTCTGGGTTGAACACAAGCCGG + Exonic
1019605323 7:1907220-1907242 GGTCCAGGTCGGGCAGGAGCTGG - Intronic
1020769437 7:12369745-12369767 GATCTTAGTTGGGCAGAAGCAGG - Exonic
1022667966 7:32428870-32428892 TGCCTACGTAGAGCAGAAGCAGG + Intergenic
1024496343 7:50051291-50051313 TGTCGAGGTTGAGGAGAAACAGG + Intronic
1024678711 7:51661350-51661372 GGTCTGCGCTCAGCAGAAGCAGG + Intergenic
1024993380 7:55253548-55253570 GCTCAAGGTTGGCCAGAAGCTGG + Intronic
1030547411 7:110914095-110914117 GGTCCAGGAAGAGCAAAAGCAGG - Intronic
1030771181 7:113476208-113476230 GGCCTAGGGTGAGCAGAAGCAGG - Intergenic
1031150669 7:118050363-118050385 GGTGAAGGTAGGGCAGAAGCAGG - Intergenic
1033463928 7:141573532-141573554 GGTCTAGTTTTAGCATCAGCTGG - Intronic
1038277013 8:26129939-26129961 GCTGTAGGTTAAGCAGAACCAGG + Intergenic
1039184307 8:34899706-34899728 AGTCAAGGTTGAGGAGAAGGTGG - Intergenic
1041098566 8:54373597-54373619 GGTCTAGGATGAAAAGTAGCCGG + Intergenic
1046626809 8:116584114-116584136 TTTCTTGATTGAGCAGAAGCTGG - Intergenic
1050536253 9:6633476-6633498 GGTCTTGCTTGAGCAGAATTGGG - Intronic
1051519589 9:17970696-17970718 GGTCAAGGGGGAGCAGAACCAGG - Intergenic
1056814595 9:89792169-89792191 GACCTGGGCTGAGCAGAAGCTGG + Intergenic
1061775470 9:132960251-132960273 GACCCAGCTTGAGCAGAAGCAGG + Intronic
1062580917 9:137228894-137228916 GGTCAAGGCTGAGCGGGAGCCGG + Exonic
1187660757 X:21544730-21544752 CGTGGAGGGTGAGCAGAAGCAGG + Intronic
1189181774 X:39011509-39011531 GTTCAAGGTTGAGCAAAAGTTGG + Intergenic
1189947149 X:46191079-46191101 GGTTCAAGTTGAGCTGAAGCTGG + Intergenic
1195596722 X:106699541-106699563 GGGGTAGGTTGAGTAGAAGCAGG - Intronic
1200695228 Y:6352651-6352673 GGTATAGGGAAAGCAGAAGCTGG + Intergenic
1201040049 Y:9822059-9822081 GGTATAGGGAAAGCAGAAGCTGG - Intergenic