ID: 1135407426

View in Genome Browser
Species Human (GRCh38)
Location 16:22207910-22207932
Sequence CTGGGGAAGAGGCAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135407419_1135407426 4 Left 1135407419 16:22207883-22207905 CCTGTAGCAAGTGCTGTTTAAGC No data
Right 1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135407426 Original CRISPR CTGGGGAAGAGGCAGGTGGA AGG Intronic
No off target data available for this crispr