ID: 1135409887

View in Genome Browser
Species Human (GRCh38)
Location 16:22225646-22225668
Sequence GCAGAGGCGAAGGTCCTACA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135409887_1135409893 16 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1135409887 16:22225646-22225668 CCTTGTAGGACCTTCGCCTCTGC 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1135409893 16:22225685-22225707 TGGCTGTGCCGGATACTGCTTGG 0: 1
1: 0
2: 0
3: 10
4: 112
1135409887_1135409894 17 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1135409887 16:22225646-22225668 CCTTGTAGGACCTTCGCCTCTGC 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1135409894 16:22225686-22225708 GGCTGTGCCGGATACTGCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 89
1135409887_1135409897 26 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1135409887 16:22225646-22225668 CCTTGTAGGACCTTCGCCTCTGC 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG 0: 1
1: 0
2: 1
3: 2
4: 99
1135409887_1135409891 5 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1135409887 16:22225646-22225668 CCTTGTAGGACCTTCGCCTCTGC 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1135409891 16:22225674-22225696 TCCAGTAACTCTGGCTGTGCCGG 0: 1
1: 0
2: 0
3: 8
4: 146
1135409887_1135409896 25 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1135409887 16:22225646-22225668 CCTTGTAGGACCTTCGCCTCTGC 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1135409896 16:22225694-22225716 CGGATACTGCTTGGGTAAAACGG 0: 1
1: 0
2: 0
3: 1
4: 47
1135409887_1135409890 -4 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1135409887 16:22225646-22225668 CCTTGTAGGACCTTCGCCTCTGC 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1135409890 16:22225665-22225687 CTGCATTTGTCCAGTAACTCTGG 0: 1
1: 0
2: 0
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135409887 Original CRISPR GCAGAGGCGAAGGTCCTACA AGG (reversed) Exonic
903288137 1:22289856-22289878 GCAGAGGGGAATGTACTAGAAGG - Intergenic
903332753 1:22604450-22604472 GGAGAGGCCAATGTCCCACATGG + Intergenic
906581500 1:46939009-46939031 GCAGAGGGGAAGGGCATTCAAGG - Intronic
909988840 1:82196448-82196470 GCAGATGCGAAGGAGCTATAAGG - Intergenic
912545527 1:110448418-110448440 CCAGAGCAGAAGGTCCTCCAAGG + Intergenic
912565761 1:110586094-110586116 GCAGAGTCCAGAGTCCTACAAGG + Intergenic
912823079 1:112882880-112882902 GCTGGGGGGAAGGTCCTGCAGGG - Intergenic
914341956 1:146767264-146767286 GCAGAGGCAAAGGTCTTCAAGGG + Intergenic
920690762 1:208144712-208144734 GCATAGGGGAAAGTCCCACAAGG - Intronic
922698681 1:227745300-227745322 GGAGAGGGGAAGGCCCTGCAGGG - Intronic
1065998311 10:31080404-31080426 TCAGAGGCCAAGGTGATACAAGG - Intergenic
1066284393 10:33950504-33950526 GAGGAGGCCCAGGTCCTACAGGG + Intergenic
1067957514 10:50808597-50808619 GCAGAGGGCAAGGTCCTTCCTGG - Intronic
1070728676 10:78809791-78809813 GCAGTGGTGATGGTCCTATATGG + Intergenic
1072663786 10:97379738-97379760 GGAGAGGCGCAGGTCACACAGGG + Exonic
1074974805 10:118571379-118571401 GCAGAGGCCAGGGTCTCACAGGG + Intergenic
1082251001 11:49980330-49980352 GCAGAGGATAAATTCCTACAGGG - Intergenic
1083494856 11:63042416-63042438 GCAGAGGGGAAGTTCCAAGATGG - Intergenic
1088828107 11:113512899-113512921 GGAGAGCCGAGGGTCTTACAGGG - Intergenic
1090905071 11:131067792-131067814 GCAGAGGTGGAGGTCCTGCCTGG + Intergenic
1104596569 12:130124353-130124375 GCAGAGCCGCAGGGCCTATATGG + Intergenic
1106901358 13:34357675-34357697 AAAGAGGCCAAGGTCCTCCATGG + Intergenic
1108733178 13:53256313-53256335 TCAGGTGTGAAGGTCCTACAAGG - Intergenic
1113378268 13:109783443-109783465 GCACGGGCGAAGGCACTACAGGG + Exonic
1114624653 14:24121039-24121061 GCTGAGGGGGAGGTCCTCCAGGG - Intronic
1115296083 14:31828670-31828692 GCTGTGGAGAAAGTCCTACATGG + Intronic
1118902772 14:70000688-70000710 GCAGAGACTGAGTTCCTACAGGG - Intronic
1124069951 15:26381834-26381856 CCAGAGACGAACTTCCTACAGGG - Intergenic
1125038815 15:35159263-35159285 GCAGAGGAGTTGGTCTTACATGG - Intergenic
1128626689 15:69214461-69214483 GCAGAAGGGAATGTCTTACATGG - Intronic
1128699539 15:69794253-69794275 GCCAAGGCTAAGGTCCTCCAAGG + Intergenic
1128703673 15:69822414-69822436 GGAACGGCTAAGGTCCTACAAGG - Intergenic
1129197818 15:73981627-73981649 GCAGAGGAGAAGTCCCTGCAAGG - Exonic
1133198933 16:4190520-4190542 GCAGAGGGGCAGGACCTGCAGGG - Exonic
1135409887 16:22225646-22225668 GCAGAGGCGAAGGTCCTACAAGG - Exonic
1137744485 16:50810643-50810665 GCAGGGGCGAAGGGGCTACCAGG - Intergenic
1139992319 16:70950161-70950183 GCAGAGGCAAAGGTCTTCAAGGG - Intronic
1142140379 16:88470154-88470176 CCACAGGCGATGCTCCTACACGG - Intronic
1147761679 17:42801742-42801764 GCAGAGGATAAGCTCCTAGAAGG + Intronic
1148453897 17:47800742-47800764 GGAGCGGCGAAGGCCCCACAAGG - Intergenic
1152563563 17:81090346-81090368 GCAGAGGCGGAGGTCCGTCCAGG - Intronic
1161206719 19:3045289-3045311 GCAGAGGGAAAGGCCCTACCTGG + Intronic
1163747942 19:19059168-19059190 GCAGGGGCGAGGGTCCAAGAGGG - Intronic
1165764357 19:38341400-38341422 GCAGAGGAGAAGGTGCTAGTGGG - Intronic
925210494 2:2041644-2041666 GCAGAGGCAAAGGTCCTCCTGGG - Intronic
935444602 2:103142721-103142743 GCAGAGGGGAAGGGCTGACAAGG - Intergenic
936145311 2:109976679-109976701 GCAGATGCTAAGGTCATACTTGG + Intergenic
936199374 2:110394799-110394821 GCAGATGCTAAGGTCATACTTGG - Intergenic
936245155 2:110820140-110820162 GCACAGGCTATGGTCCCACATGG - Intronic
937847825 2:126601125-126601147 GCAGAGGGGATGGGCCTGCATGG + Intergenic
942321515 2:174740651-174740673 GTAGATGGGAAGGTCCTCCATGG - Intergenic
944894558 2:204150892-204150914 GCAGAGGCCAGGGTGCTTCAGGG + Intergenic
946579243 2:221108452-221108474 GCAAAGGGGAAGGTGCTACATGG + Intergenic
1172358654 20:34297074-34297096 CCAGAGGCCAAGCTCCAACAAGG + Intronic
1173144014 20:40509637-40509659 GCAGATGCTAAGGGCCAACATGG + Intergenic
1173400016 20:42717218-42717240 GCAGAGGTGTAGGTCTTACATGG + Intronic
1182857158 22:33527874-33527896 GCAGAGGTGGAGTTCCTGCATGG + Intronic
949333833 3:2951647-2951669 ACAGATGAAAAGGTCCTACAAGG + Intronic
949774696 3:7619569-7619591 GTAGAGGGGACGGTCCTGCAAGG + Intronic
960326017 3:116296819-116296841 GCAGATTCCAAGGTCCTCCATGG - Intronic
966410387 3:179641165-179641187 GGAAAGGAGAAGGTGCTACACGG - Intergenic
966846664 3:184135669-184135691 GCATAGACGCAGGTCCTTCAAGG - Intronic
967983120 3:195077426-195077448 GCAGAGGCTGAGCACCTACAGGG - Intronic
988697992 5:33643297-33643319 GCTGAGGAGAAGGCCCTAGAGGG - Intronic
990786564 5:59426928-59426950 GCAGAGGGGAATTTCCTAGAGGG - Intronic
991320752 5:65370739-65370761 GCAGAGGGGAAGCTCCAACTGGG + Intronic
993912551 5:93702282-93702304 GAAGAGACTAAGGTCCTAAAAGG + Intronic
1004144679 6:13054302-13054324 GCAGAGGGAAATGTGCTACAGGG + Intronic
1010487282 6:76430481-76430503 GAAGAGGAGAAGGTCCTTGATGG + Intergenic
1010635680 6:78256740-78256762 ATAGAGGAGAAGGTCTTACATGG - Intergenic
1018798686 6:167206580-167206602 GCAGGAGCGAAGGGCCCACAAGG + Intergenic
1019646960 7:2135992-2136014 GCAGAGGGAAAGCTCCTTCAGGG + Intronic
1019751666 7:2734644-2734666 GCAGAGAGGAAGCTCCTTCAGGG + Intronic
1021207450 7:17801352-17801374 GTGGAGGCGAAGGTCCTAACAGG + Intronic
1021679347 7:23114242-23114264 GCACAGTCGTATGTCCTACATGG - Intronic
1024307159 7:47938585-47938607 GCTCAGGCGAAGGTCACACAGGG - Intronic
1025942289 7:66083167-66083189 GCAGAGGCGTGAGTCCTACAGGG + Exonic
1032447979 7:132001077-132001099 GCAGAGCAGCAGGTCCAACACGG - Intergenic
1049851930 8:144837261-144837283 GCACAGGCCAAGCTCCTGCAGGG - Intronic
1052766382 9:32645320-32645342 GAAGAGGGCACGGTCCTACAAGG - Intergenic
1056479455 9:86986309-86986331 GCAGAGAAGAAGGTACTAAATGG - Intergenic
1057509247 9:95663927-95663949 GCAGAGACGCAGGCCCTAGAGGG - Intergenic
1061409058 9:130408739-130408761 GCAGAGGCTCCTGTCCTACAAGG + Intronic
1062547966 9:137072195-137072217 GCAGAGGGGAAGGGCCTTCCTGG - Intergenic
1188379150 X:29470146-29470168 GCAGTGGGAGAGGTCCTACATGG - Intronic
1190114341 X:47616468-47616490 GCAGACGCAAAGGACCTGCATGG + Intronic
1195679421 X:107532781-107532803 GGAGAGGGGAAGCTCCTTCAGGG + Intronic
1198262983 X:134983050-134983072 GCAGAGATGAAGGCTCTACATGG - Intergenic
1200162795 X:154018009-154018031 GCAGTGGAGACGGTCCTCCAGGG + Exonic