ID: 1135409888

View in Genome Browser
Species Human (GRCh38)
Location 16:22225656-22225678
Sequence CTGGACAAATGCAGAGGCGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 177}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135409888_1135409891 -5 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1135409888 16:22225656-22225678 CCTTCGCCTCTGCATTTGTCCAG 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1135409891 16:22225674-22225696 TCCAGTAACTCTGGCTGTGCCGG 0: 1
1: 0
2: 0
3: 8
4: 146
1135409888_1135409897 16 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1135409888 16:22225656-22225678 CCTTCGCCTCTGCATTTGTCCAG 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG 0: 1
1: 0
2: 1
3: 2
4: 99
1135409888_1135409898 25 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1135409888 16:22225656-22225678 CCTTCGCCTCTGCATTTGTCCAG 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1135409898 16:22225704-22225726 TTGGGTAAAACGGGCACCCCAGG 0: 1
1: 0
2: 0
3: 2
4: 65
1135409888_1135409893 6 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1135409888 16:22225656-22225678 CCTTCGCCTCTGCATTTGTCCAG 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1135409893 16:22225685-22225707 TGGCTGTGCCGGATACTGCTTGG 0: 1
1: 0
2: 0
3: 10
4: 112
1135409888_1135409896 15 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1135409888 16:22225656-22225678 CCTTCGCCTCTGCATTTGTCCAG 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1135409896 16:22225694-22225716 CGGATACTGCTTGGGTAAAACGG 0: 1
1: 0
2: 0
3: 1
4: 47
1135409888_1135409894 7 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1135409888 16:22225656-22225678 CCTTCGCCTCTGCATTTGTCCAG 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1135409894 16:22225686-22225708 GGCTGTGCCGGATACTGCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135409888 Original CRISPR CTGGACAAATGCAGAGGCGA AGG (reversed) Exonic
900137346 1:1123341-1123363 GTGGACAAAGGCAGAAGTGAAGG + Intergenic
900363230 1:2299978-2300000 CAGGACCTATGCAGAGGCGGTGG - Intronic
901886238 1:12225284-12225306 GTGGAAAAATGCACAGGCCAAGG + Intergenic
901906548 1:12417034-12417056 CTGGACTAAGGCAGTGGCAACGG - Intronic
904079775 1:27864715-27864737 CTTCACACATGCAGAGGCAATGG - Intergenic
905793303 1:40801737-40801759 CTGGACAATGACAGAGGAGAAGG + Intronic
912541337 1:110418224-110418246 CTGGAATAATGCACAGGTGAAGG - Intergenic
916288964 1:163142677-163142699 CTAGAAAAATGCACAGGCTAAGG - Intronic
917963011 1:180159166-180159188 ATGGACTAATGGAGAGGGGAAGG - Intronic
918322260 1:183375441-183375463 CTGGGCAAAGGCATAGGGGAGGG - Intronic
918628120 1:186681292-186681314 ATGGACAAAGGAAGCGGCGATGG + Intergenic
918981413 1:191564763-191564785 CTGGAGAAATGCAGAAGAAAGGG + Intergenic
921678774 1:218007321-218007343 GTGCACAAATGCAGTGGCTATGG + Intergenic
923540401 1:234884584-234884606 CTTGGCACATGCAGAGGAGAGGG + Intergenic
1063311105 10:4952800-4952822 CTGGAGAAATGCAGAGATGCAGG + Intronic
1063316693 10:5013595-5013617 CTGGAGAAATGCAGAGATGCAGG - Intronic
1064295544 10:14076122-14076144 CTGGGCAAATGAACAGGTGAAGG - Intronic
1070775425 10:79107029-79107051 CTGGCCAGATGCAAAGGCAATGG - Intronic
1073073543 10:100809491-100809513 ATAGACAAAGGGAGAGGCGAAGG - Intronic
1077490565 11:2859080-2859102 TTGCCCAAATGCAGAGGCCAGGG - Intergenic
1077790073 11:5429621-5429643 ATGGGCAGATGCAGAGGGGAGGG + Intronic
1078014898 11:7604603-7604625 CTGGACAAATGCATGGGTGTGGG - Intronic
1078030530 11:7746572-7746594 AAGGACAGATGCAGAGGAGATGG - Intergenic
1080009431 11:27442745-27442767 CTAGACAAATGAAGAAGAGAGGG + Intronic
1082985732 11:59169493-59169515 CTGGTCAAAAGCAGAGACCATGG - Intergenic
1085844997 11:80054924-80054946 CTGAACAAAGGAAGAGGCAAAGG + Intergenic
1094172253 12:27505806-27505828 GTGGACAAATGTGGAGGGGATGG - Intergenic
1095342179 12:41103750-41103772 CTGAACTAATGCCGAGGAGAGGG + Intergenic
1097496821 12:60350137-60350159 CCGGGCAAATGCAAAGGTGAAGG + Intergenic
1098454010 12:70652053-70652075 CTGGACAGATTCAGAGCTGAAGG + Intronic
1098468779 12:70820657-70820679 CTGGCCAAAGGCAGAGCCCAAGG - Intronic
1100223657 12:92534504-92534526 CTGGACACGTGTAGAGGCTAAGG + Intergenic
1100667662 12:96772156-96772178 CTGGACACTTGCAGAGAAGATGG - Intronic
1100678857 12:96897481-96897503 CTGGACTCAGGCAGAGGCAATGG - Intergenic
1104375376 12:128261467-128261489 TGGGAGAAATGCAGAGGAGAAGG + Intergenic
1104530982 12:129570959-129570981 CAGGACGAATGCAGAAGCCAAGG + Intronic
1104715847 12:131015694-131015716 CTGGTCACATGCAGAGAGGAAGG - Intronic
1104930698 12:132337962-132337984 CTGGACATGTGCAGATGTGAAGG + Intergenic
1105583738 13:21724712-21724734 CTGGAGAAAAGCAGAGGCTGTGG - Intergenic
1106605285 13:31223292-31223314 CTGGGGGAATGCAGAGGGGAAGG + Intronic
1112266622 13:97929993-97930015 GTGGCCAAATTCAGTGGCGACGG - Intergenic
1112996912 13:105585657-105585679 CTTGACCTATGCAGAGGAGATGG - Intergenic
1117211373 14:53503893-53503915 ATGGACAAATGGAGAGGAGAAGG + Intergenic
1117882241 14:60323460-60323482 CAGGGGAAATGCTGAGGCGAAGG - Intergenic
1118749409 14:68795397-68795419 CTGGAAAAAAGCAAAGGGGAAGG + Intronic
1119423707 14:74522962-74522984 CTGGACAAAGGCAGTGGAGCGGG + Intronic
1121918025 14:97854085-97854107 CAGGAGAAATGCAGACGTGATGG - Intergenic
1123968155 15:25479651-25479673 CTGGTCAAATGAGGAGGGGAAGG + Intergenic
1126382928 15:48066908-48066930 CTGAACAAAGGCAGTGGGGAGGG + Intergenic
1126575041 15:50188215-50188237 CTGAACAAATGCAGTGGGGGAGG + Intronic
1127354287 15:58183129-58183151 CAGGATAAATGCAGAGGGGATGG - Intronic
1128128719 15:65211465-65211487 CTGGACTGCTGGAGAGGCGAAGG - Exonic
1128552775 15:68609040-68609062 CTGGAGAAATGCTGAGGCCAGGG + Intronic
1129455707 15:75675319-75675341 CTGGAGAACTGCAGGGGCCAAGG - Exonic
1130312538 15:82767863-82767885 CTGGAGAAATGAAGAGGTGTTGG - Intronic
1130448917 15:84031103-84031125 ATGGACTAATACAGAGGGGATGG + Intronic
1131374324 15:91911054-91911076 CAGGACACATTCAGAGGCCACGG - Intronic
1131394924 15:92078572-92078594 CTGGGCAAAGGCAGAGGTGTGGG - Intronic
1133412663 16:5581113-5581135 CTTGACAGATCCAGAGGAGAAGG + Intergenic
1133895893 16:9928574-9928596 CTGGAGAGATGAGGAGGCGATGG - Intronic
1133895906 16:9928679-9928701 CTGGACAGATGAGGAGGTGATGG - Intronic
1135354206 16:21756049-21756071 CTGGACAAAAGAGGAGGAGAGGG + Intronic
1135409888 16:22225656-22225678 CTGGACAAATGCAGAGGCGAAGG - Exonic
1135452696 16:22572190-22572212 CTGGACAAAAGAGGAGGAGAGGG + Intergenic
1139273150 16:65702063-65702085 CTGAACATAAGCAGGGGCGACGG - Intergenic
1141066469 16:80917795-80917817 ATGGACAGATGCAGATGCCATGG + Intergenic
1141112698 16:81283082-81283104 AAGTACAAATGCAGAGGCAATGG - Intronic
1142242144 16:88952433-88952455 CAGGACAAATGCCCAGGCCATGG + Intronic
1142478711 17:204926-204948 CTGGGCAAAGGTGGAGGCGATGG + Intergenic
1144175400 17:12700299-12700321 CTGGACAAAGGCAGTGGAAATGG - Intronic
1144820164 17:18067225-18067247 CTGGAAAAATGCAGAAGGTATGG - Exonic
1145290180 17:21537623-21537645 CTCAGCAAATGCAGAGGGGATGG + Intronic
1146602837 17:34233712-34233734 CTGGACAAGTCCAGAGGGGAGGG - Intergenic
1146659798 17:34658138-34658160 AGGGACAGATGCAGAGGCAAAGG - Intergenic
1147488846 17:40844841-40844863 CTGGACAAAGGGAGATGAGATGG + Intergenic
1147699884 17:42387369-42387391 TTGGGTAAATGCAGAGGAGAGGG - Intronic
1148441432 17:47713596-47713618 CTGAGAAAATGCAGAGGCAAAGG + Intergenic
1149777879 17:59372217-59372239 CTGGGAAAATTCAGAGGCCAGGG - Intronic
1150042109 17:61874215-61874237 CAGGAAAGATGCAGAGGAGATGG - Intronic
1150640417 17:66946004-66946026 TTGGGCAAAGGCAGAGGCGGTGG - Intergenic
1151129709 17:71883653-71883675 CTGGACTAATGCAGTGGCACTGG + Intergenic
1152288525 17:79425790-79425812 CTGGACAGTTGCAGTGGAGATGG + Intronic
1152563184 17:81088862-81088884 CCGGACAAAGGCAGAGGCTGGGG + Intronic
1155379626 18:25205564-25205586 ATGGACAATTGGAGAGGTGAAGG + Intronic
1157129872 18:44996804-44996826 CTGGATTAAGGCAGAGGCAAGGG + Intronic
1157306474 18:46521155-46521177 CTGGCCAAGGACAGAGGCGACGG - Exonic
1160193579 18:76735120-76735142 CTGGACAAATGCATCGGCTGTGG - Intergenic
1160879547 19:1313236-1313258 CTGGACAAAGGCACAGTGGAGGG - Intergenic
1164773483 19:30831607-30831629 CTGGCAAAATGCAGAAGGGAAGG - Intergenic
925982636 2:9189622-9189644 CTGGACGCAGGCAGAGGGGAAGG + Intergenic
926745343 2:16152337-16152359 CATGGCAAATGTAGAGGCGATGG + Intergenic
927757469 2:25720493-25720515 CTGAGCAAATGCAGAGGAAATGG + Intergenic
932458302 2:71864109-71864131 TTGGCCAACGGCAGAGGCGATGG + Intergenic
933105201 2:78316028-78316050 CTGGACAGGAGCAGAGGTGAGGG + Intergenic
934150849 2:89146307-89146329 AGGGACAAATGCAGTGGCCATGG - Intergenic
934216427 2:90035718-90035740 AGGGACAAATGCAGTGGCCATGG + Intergenic
936409074 2:112238022-112238044 CTTCACACATGCAGAGGCCAGGG + Intronic
936922407 2:117702371-117702393 CTGGGCAAATGGAGAGGTGGTGG - Intergenic
938407672 2:131041491-131041513 CTGGAGGCATGCAGAGGCGTGGG - Intronic
938761585 2:134431061-134431083 CTGGACAAGTCCAGATGTGAAGG + Intronic
940013157 2:149076080-149076102 CTGGAGTAATCCAGAGGCGCGGG + Intronic
940550779 2:155153002-155153024 CTAGACAAATGCAAAGGAAATGG + Intergenic
942338118 2:174913235-174913257 CTGGAGAAATGCAGGGGAAATGG + Intronic
942672747 2:178393978-178394000 CAGGACAACTGCAGAGTCCAGGG - Intronic
944034204 2:195273868-195273890 ATGAAAAAATGCAGATGCGATGG + Intergenic
945531286 2:210956386-210956408 CTGAACAAATGGAGAGCCCAAGG - Intergenic
1172887722 20:38242223-38242245 CTGGATAGATGCAGAGAGGAAGG - Intronic
1173239674 20:41283293-41283315 CTGGACAGATGTGGAGGAGAGGG - Intronic
1174149300 20:48474902-48474924 CTGGAGAACTGGAGAGGAGATGG - Intergenic
1175065900 20:56288206-56288228 CAGGACAAATTCAGAGGCCATGG - Intergenic
1176218656 20:63959764-63959786 CTGGACGGATGAAGAGGCGGGGG + Exonic
1179159428 21:38880308-38880330 CAGGACAAATGCAGAAAGGAAGG - Intergenic
1181573219 22:23779054-23779076 CTGGGCAAATGGAGAGGGAAAGG - Intronic
1182035725 22:27196831-27196853 CTGGAGACATGCAGAGGAAAGGG - Intergenic
950021229 3:9789232-9789254 TTGGACCAAAGCAGAGGGGATGG + Intronic
960488221 3:118278968-118278990 CTAGCCAAATGCAGAGGCCAAGG - Intergenic
961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG + Intronic
961339977 3:126211588-126211610 CGGGTCAGATGCAGAGGCGGAGG - Intergenic
962087745 3:132209536-132209558 CTAGACAAATGCATAAGCAAAGG + Intronic
964040390 3:152254373-152254395 CAGGACAAGGGCAGAGGCAATGG - Intronic
965731191 3:171774221-171774243 CTGGTCAAATGCAAGGGCGGGGG + Intronic
966374255 3:179279535-179279557 CTGGAAAAATTCAGAGGTGAGGG + Intergenic
967123787 3:186406982-186407004 CTGAAAAAATGAAAAGGCGAGGG - Intergenic
969588493 4:8108207-8108229 CTGGCAGAATGCAGAGGGGAGGG - Intronic
969626291 4:8307368-8307390 CTGGACAGAGGCAGAGGCCAAGG - Intergenic
969705866 4:8791205-8791227 CTGAACAAATGAAGTGGAGAGGG - Intergenic
970141560 4:12988087-12988109 CTGGATGATTGCAGAGGTGAAGG + Intergenic
970969892 4:21970024-21970046 CTGGACACATGCAGAGGGAATGG + Intergenic
981041254 4:140224486-140224508 CTTGACCAATGCAGAGGTCAGGG + Intergenic
983387587 4:167084974-167084996 CTGGACAAAAGTAGAGGGAAGGG - Intronic
985110651 4:186543473-186543495 CTGGCCAACTGCAGAAGTGAGGG + Intronic
987269264 5:16288586-16288608 CTGGTCAAGTGCAAAGGAGAGGG + Intergenic
987901693 5:24020603-24020625 ATGGACAAATCCAGAGTCAATGG + Intronic
989127360 5:38069523-38069545 TTGGACAAACACAGAGGCCAAGG + Intergenic
990897021 5:60710432-60710454 CAGGAAAAATACAGAGCCGAAGG + Intergenic
992762988 5:79968083-79968105 CTGAACAAAAGCAGAGGCCATGG - Intergenic
993919261 5:93780292-93780314 CTGGAGAATTTCAGAGGCCAGGG + Intronic
995859829 5:116629500-116629522 ATGGACAAATGCAGTGGTCATGG + Intergenic
997001511 5:129767476-129767498 CATGGAAAATGCAGAGGCGATGG + Intergenic
998084416 5:139305885-139305907 ATGGACAAATACAGTGGCAAAGG - Intronic
999320897 5:150614436-150614458 TTGGACTCATGCAGAGGTGAAGG + Intronic
999367357 5:151031775-151031797 CATGACAAATGCAGAGGCCGTGG - Intronic
1000777620 5:165440052-165440074 CTGGACCAATGGAGAGGCCAAGG - Intergenic
1001756299 5:174172911-174172933 CTGCACAGATGCAGATGTGAAGG + Intronic
1003174225 6:3743428-3743450 CTACACAGATGCAGAGGTGAAGG + Intronic
1006308416 6:33239519-33239541 CTGGAGGAATGCAGAGGAAACGG + Intergenic
1006599983 6:35218872-35218894 TTAGACAAATGCAGAGCCTAAGG + Intronic
1009781732 6:68280089-68280111 CTTGAGAAATGGAGAGGGGAGGG + Intergenic
1010737766 6:79461775-79461797 CTGGACAGCAGCAGAGGAGAGGG - Intergenic
1011213625 6:84981328-84981350 CTGGAGAAATGCAGAGGATGAGG + Intergenic
1017845667 6:158255913-158255935 CTGGGGAAATGCAGAGGCCTTGG + Intronic
1018110704 6:160534575-160534597 CTGGACACATGAAGGGGAGAGGG + Intronic
1020150576 7:5678838-5678860 CTGGATAAATTAAGAGGCAAAGG + Intronic
1022306775 7:29154072-29154094 CTCGAGAAATGCAGAGGTTAGGG - Intronic
1023654494 7:42406395-42406417 ATGGAGAAATGCAGAGGGAAAGG - Intergenic
1024357329 7:48427491-48427513 CTGGTCAAATGCATAGGCAGTGG - Intronic
1026178936 7:68021881-68021903 CAGCACAAATGCAGAGGCAGTGG + Intergenic
1027218362 7:76198557-76198579 CTGGGCAAAGGAAGAGGGGAGGG + Intergenic
1028765284 7:94550334-94550356 CTGGAAAAATGCATAGGGGTTGG - Intronic
1029854447 7:103500821-103500843 TTGGACAACTGCAGGGGCCATGG - Exonic
1034285453 7:149880715-149880737 CTGCACACAGGCAGAGGCCAGGG - Intergenic
1034313974 7:150112711-150112733 CTGGAGAATTCCAGAGGGGATGG - Intergenic
1034792923 7:153988081-153988103 CTGGAGAATTCCAGAGGGGATGG + Intronic
1035337380 7:158138551-158138573 GTGGACGAATGCAAAGGTGAGGG + Intronic
1036392247 8:8333735-8333757 CAGAACAAATGCAGAAGCAAAGG + Intronic
1036583421 8:10099975-10099997 CAGGACAAAGGCAGAGGGGATGG + Intronic
1040393884 8:46976104-46976126 ATGGCCAGATGCAGATGCGATGG + Intergenic
1044448125 8:92302121-92302143 ATGGGCAAGTGCAGAGGCCATGG + Intergenic
1044666827 8:94640806-94640828 CTGGATGAATGGAGAGGCGAGGG - Intergenic
1046023092 8:108689868-108689890 CTGGAGAAATGGAGAGGAGGGGG - Intronic
1046281586 8:112040291-112040313 CTGGAGAAATGAAGAAGCTATGG + Intergenic
1046974826 8:120262532-120262554 TTGGACAGATGCAGATGTGAGGG - Intronic
1047112868 8:121810108-121810130 ATGGACAAAGGCAGAAGTGAAGG + Intergenic
1050065886 9:1759157-1759179 CTTGACAGATGCAGAGGCCTGGG + Intergenic
1050698887 9:8314222-8314244 ATGGACAAAAGCAAAGGCCAGGG + Intergenic
1054834240 9:69659527-69659549 GTGGATGGATGCAGAGGCGATGG - Intronic
1055806313 9:80097879-80097901 TTGGAAAAATGCAGATGCCAGGG + Intergenic
1055996374 9:82164347-82164369 CTGCACAAATGCAGCAGCCATGG - Intergenic
1056228317 9:84518870-84518892 CTGGAAGAATTGAGAGGCGAAGG - Intergenic
1059391247 9:114000985-114001007 GTGGACAAATGCAGAGGCCCCGG - Intronic
1060932285 9:127496763-127496785 CTGGACAGATGCAGACACCAGGG + Intronic
1061921533 9:133785159-133785181 CTGGTGAAATGGAGAGGGGAAGG - Intronic
1061978284 9:134084605-134084627 CTGGAAGAATGCAGAAGGGAAGG + Intergenic
1185479572 X:435837-435859 CTGGGAAAATGCAGAGCTGAGGG + Intergenic
1187677655 X:21733884-21733906 CTGGACAAATGGAGTGTCCAGGG - Intronic
1192221844 X:69202762-69202784 CTTGCCAAATGCACAGGCCAAGG - Intergenic
1192589123 X:72345299-72345321 CTAGAAAAAAGCAGAGGAGATGG + Intronic
1195517643 X:105795759-105795781 CTGGTTAAATGCAGAAGGGAAGG - Intergenic
1195667887 X:107447368-107447390 CTGGACAAATGCACATCTGAGGG - Intergenic
1199159923 X:144597001-144597023 CTTGACAATTGCAGAGGAAAAGG - Intergenic
1200042480 X:153380028-153380050 CTGCACAGAGGCAGAGGCTAAGG + Intergenic
1200270591 X:154678929-154678951 ATGGACTAATACAGAGGCCAAGG + Intronic