ID: 1135409889

View in Genome Browser
Species Human (GRCh38)
Location 16:22225662-22225684
Sequence GAGTTACTGGACAAATGCAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 197}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135409889_1135409894 1 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1135409889 16:22225662-22225684 CCTCTGCATTTGTCCAGTAACTC 0: 1
1: 0
2: 0
3: 22
4: 197
Right 1135409894 16:22225686-22225708 GGCTGTGCCGGATACTGCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 89
1135409889_1135409896 9 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1135409889 16:22225662-22225684 CCTCTGCATTTGTCCAGTAACTC 0: 1
1: 0
2: 0
3: 22
4: 197
Right 1135409896 16:22225694-22225716 CGGATACTGCTTGGGTAAAACGG 0: 1
1: 0
2: 0
3: 1
4: 47
1135409889_1135409893 0 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1135409889 16:22225662-22225684 CCTCTGCATTTGTCCAGTAACTC 0: 1
1: 0
2: 0
3: 22
4: 197
Right 1135409893 16:22225685-22225707 TGGCTGTGCCGGATACTGCTTGG 0: 1
1: 0
2: 0
3: 10
4: 112
1135409889_1135409899 26 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1135409889 16:22225662-22225684 CCTCTGCATTTGTCCAGTAACTC 0: 1
1: 0
2: 0
3: 22
4: 197
Right 1135409899 16:22225711-22225733 AAACGGGCACCCCAGGAACATGG 0: 1
1: 0
2: 0
3: 8
4: 112
1135409889_1135409897 10 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1135409889 16:22225662-22225684 CCTCTGCATTTGTCCAGTAACTC 0: 1
1: 0
2: 0
3: 22
4: 197
Right 1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG 0: 1
1: 0
2: 1
3: 2
4: 99
1135409889_1135409898 19 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1135409889 16:22225662-22225684 CCTCTGCATTTGTCCAGTAACTC 0: 1
1: 0
2: 0
3: 22
4: 197
Right 1135409898 16:22225704-22225726 TTGGGTAAAACGGGCACCCCAGG 0: 1
1: 0
2: 0
3: 2
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135409889 Original CRISPR GAGTTACTGGACAAATGCAG AGG (reversed) Exonic
901152327 1:7112127-7112149 GTGCCACTGGACAAATGCACCGG - Intronic
901249102 1:7759442-7759464 AAGTTACTGGATAAATTAAGAGG - Intronic
901611013 1:10497990-10498012 AAGTTACTGGCCAGGTGCAGTGG + Intronic
902896453 1:19483779-19483801 AAGTTACTGGACAAATCCGAAGG + Intronic
908720317 1:67118575-67118597 GAGTTTCTGGGGAAATGCTGGGG + Intronic
912186132 1:107278061-107278083 GAGCTCATGGACAAATGCAGGGG - Intronic
912868993 1:113286142-113286164 GACTTAGTGGACAATTACAGAGG - Intergenic
914739540 1:150452176-150452198 GAGAAACTGGACAAAAGCACAGG + Intronic
915037540 1:152941477-152941499 GAGAGACTGGGCAAAGGCAGAGG + Intergenic
915914581 1:159933217-159933239 GAGATACTGGACATAGGAAGAGG - Intronic
918100746 1:181371557-181371579 GAGCTTCTGGCCAGATGCAGTGG - Intergenic
919413907 1:197282397-197282419 GAGTTACTGGACCAATGAGTAGG - Intronic
1063814891 10:9760158-9760180 GATTTCATGGCCAAATGCAGTGG - Intergenic
1065765819 10:29028450-29028472 GGGTTACTGGAGCAATGCAGGGG - Intergenic
1070906413 10:80077480-80077502 GGGTTACTGGCCAAGCGCAGTGG - Intergenic
1072917755 10:99549886-99549908 CAGTTAGTGGACAAAAGGAGAGG - Intergenic
1073796926 10:106998657-106998679 GATTTACTGGAGAAATGAAAGGG - Intronic
1073836984 10:107455516-107455538 GAGATCCTGGAATAATGCAGTGG - Intergenic
1076256315 10:129028032-129028054 GGGTGACTGGATAAATTCAGTGG - Intergenic
1076708033 10:132312750-132312772 GAGTTCCAGGCCAGATGCAGTGG + Intronic
1079755784 11:24259494-24259516 GAGTGCCTGGAGAAATCCAGGGG + Intergenic
1079830566 11:25262493-25262515 CAGTTTCTGGCCAACTGCAGTGG - Intergenic
1081048188 11:38303220-38303242 TAGTTACTGGTGAAATTCAGAGG - Intergenic
1082171803 11:49013796-49013818 AAGTCACTGGACAAATGCAATGG + Intergenic
1083663928 11:64264702-64264724 GAGTTACTGAGCACATGCAGTGG + Intronic
1084035895 11:66510225-66510247 GGGTTATGGGACAAATGCAGAGG - Intronic
1085429064 11:76430845-76430867 AATTTACTGAATAAATGCAGAGG - Intergenic
1086018247 11:82193665-82193687 GAGTGACTGGACACAGACAGCGG + Intergenic
1087243290 11:95804904-95804926 AAATTACTGAATAAATGCAGAGG - Intronic
1091689633 12:2586968-2586990 GAATTATTGAACAAATGCAATGG + Intronic
1092923745 12:13255966-13255988 GAGTCACGGGACAAAGGGAGAGG + Intergenic
1092984262 12:13830110-13830132 GAGATATTTGACAAAAGCAGGGG + Intronic
1097120959 12:56731544-56731566 GATTTCCTGGCCAAGTGCAGTGG - Intronic
1097130341 12:56806673-56806695 GAGATACAGGAAAAAGGCAGAGG - Intergenic
1097141037 12:56902719-56902741 GAGGTACAGGAAAAAGGCAGAGG + Intergenic
1098234337 12:68404030-68404052 CAGTTACTTGACAACTGCAGGGG + Intergenic
1099355441 12:81629348-81629370 GATTTACTGAAAAAATGTAGTGG - Intronic
1099693836 12:85993756-85993778 GAGATACAGGAAAAAGGCAGAGG + Intronic
1100662041 12:96710002-96710024 GAATTATTGGCCACATGCAGTGG - Intronic
1100776034 12:97975783-97975805 GAGTTACCGGATGAATCCAGGGG - Intergenic
1101216520 12:102591038-102591060 GAGTTACTGGAAGATTGAAGTGG + Intergenic
1101651233 12:106679168-106679190 GCCTTACTGGCCAAGTGCAGTGG + Intronic
1102352641 12:112205540-112205562 AAATTACAGGACAAATGGAGAGG + Intronic
1102758022 12:115359358-115359380 GAGTTATTGGACACACACAGAGG - Intergenic
1103631642 12:122266314-122266336 GAGTTCCTGGACAAGTGCGCAGG - Exonic
1104822012 12:131682505-131682527 CAGCCACTGGACTAATGCAGGGG + Intergenic
1107006901 13:35621934-35621956 GAGGTACTGTACAAATGAATGGG - Intronic
1108500108 13:51062319-51062341 GGGTTACTGGACAGAGGCAGAGG + Intergenic
1109719748 13:66260485-66260507 GACTTAAAGGACGAATGCAGGGG + Intergenic
1111273932 13:85923594-85923616 GATTTTCTGGACAATTGCTGTGG + Intergenic
1112227471 13:97553746-97553768 GGGTTACTGGACAAATGCTTTGG + Intergenic
1116466084 14:45234413-45234435 GAGCTAGTGTACAAATGGAGAGG + Intronic
1118877453 14:69797257-69797279 GAGTTTCTGGACAAAAGCTCTGG + Exonic
1119593915 14:75916352-75916374 GAATTACTGGCCAGGTGCAGTGG + Intronic
1119718490 14:76875190-76875212 GAGTGACTGGCTAAATGCTGTGG + Intergenic
1119837975 14:77768169-77768191 GTGTTCCTGGCCAAAAGCAGTGG - Intronic
1120876926 14:89383618-89383640 AAGAGACTGGACCAATGCAGGGG - Intronic
1121194222 14:92055615-92055637 GAGCTTCTAGTCAAATGCAGAGG - Exonic
1122342386 14:101036971-101036993 AAGTTGCTGGCCAGATGCAGTGG - Intergenic
1123829983 15:24125576-24125598 GAGTTACTTGAAAAATTCACTGG - Intergenic
1123974374 15:25539003-25539025 GAGTAACTGGCCAGGTGCAGTGG + Intergenic
1124083512 15:26523672-26523694 TATTTACTGGCCAAGTGCAGTGG + Intergenic
1126622611 15:50655146-50655168 AACTTCCTGGCCAAATGCAGTGG + Intronic
1127292932 15:57586309-57586331 TAGATACTGGCCAAGTGCAGTGG - Intergenic
1129628635 15:77233176-77233198 AAGGTAATGGAGAAATGCAGTGG - Intronic
1129992974 15:79980719-79980741 AAGTCACTGGTCAGATGCAGTGG - Intergenic
1131523614 15:93135474-93135496 GAGTTATTGGCCAGGTGCAGTGG - Intergenic
1131674681 15:94659932-94659954 AAGTTACTGCTCAAATACAGGGG + Intergenic
1133056331 16:3147288-3147310 GAGCAACTGGACACCTGCAGGGG + Exonic
1134773680 16:16833172-16833194 GAGCAACTGGGCAGATGCAGAGG + Intergenic
1135207415 16:20494776-20494798 GAGTTACAGGAAAAAGGCAGAGG + Intergenic
1135211470 16:20528856-20528878 GAGTTACAGGAAAAAGGCAGAGG - Intergenic
1135409889 16:22225662-22225684 GAGTTACTGGACAAATGCAGAGG - Exonic
1136345832 16:29675234-29675256 GATTTATTGGCCAAGTGCAGTGG + Intronic
1136677547 16:31925697-31925719 TAGTTAGTGGAGAAATGCAGGGG + Intergenic
1137534558 16:49308505-49308527 GAGTTCCTGGTCAGGTGCAGTGG - Intergenic
1137602005 16:49762625-49762647 GACTTACTTTACAAGTGCAGAGG + Intronic
1140403602 16:74692238-74692260 CAGAAAATGGACAAATGCAGGGG + Intronic
1141490147 16:84367425-84367447 AATTTCGTGGACAAATGCAGAGG + Intergenic
1143073978 17:4323828-4323850 TAGTTACTGGCCAGGTGCAGTGG - Intronic
1143860023 17:9882528-9882550 GAGTTTCTGCACACATACAGAGG + Intronic
1144935156 17:18892140-18892162 GAGGTACTGGCCAAGTGCGGTGG - Intronic
1145245638 17:21267602-21267624 AAGTTACTGGCCAGAAGCAGTGG - Intergenic
1150247145 17:63684987-63685009 CAGTTCCTGGTCCAATGCAGAGG - Intronic
1150346968 17:64411805-64411827 CAGTGAGTGGGCAAATGCAGTGG + Intronic
1150771493 17:68045300-68045322 GATTTACTGGACATATGGAATGG - Intronic
1150937805 17:69656587-69656609 AACTTACTGTACAAATTCAGAGG + Intergenic
1151463378 17:74268985-74269007 GAGTTTCTGGCCAAGTGCAGTGG + Intergenic
1153451652 18:5237532-5237554 GAATGACTGGACAAGTGCACGGG - Intergenic
1155420756 18:25652984-25653006 TGGGTAGTGGACAAATGCAGAGG + Intergenic
1156783107 18:40875994-40876016 GAGATACTGCACAAAAGCAGAGG - Intergenic
1157931934 18:51833001-51833023 ATGTTACTGGCCAGATGCAGTGG + Intergenic
1158328977 18:56340568-56340590 GTGTAACTGGACAACTGGAGTGG + Intergenic
1158698363 18:59723275-59723297 GCATTACTGGCCAGATGCAGTGG + Intergenic
1159904191 18:74075567-74075589 GTATTAATGGACAAATCCAGCGG - Intronic
1160193580 18:76735126-76735148 GAACTTCTGGACAAATGCATCGG - Intergenic
1160624935 18:80197340-80197362 GAGTTACTAGAAAAAGGAAGGGG - Intronic
1161801573 19:6419196-6419218 GACTTACTGGACAGATTCTGGGG + Exonic
1161827952 19:6581966-6581988 GAGAAACTGGACAAACGAAGGGG + Intergenic
1163935007 19:20434649-20434671 GCATTACTGGCCAGATGCAGTGG + Intergenic
1163964787 19:20735270-20735292 GCTTTTCTGGACAGATGCAGTGG - Intronic
1164754535 19:30679900-30679922 GAGTTACTTGCCAGATGCACAGG + Intronic
1166554249 19:43687758-43687780 GAGAGAATGGACAAAGGCAGTGG + Intergenic
926900809 2:17750235-17750257 GAGTTGCTAAACAAAAGCAGTGG + Intronic
926987838 2:18643417-18643439 GATTTCCTGGACTAAGGCAGTGG + Intergenic
928355489 2:30610087-30610109 TAGTTATTAGAAAAATGCAGGGG - Intronic
929290370 2:40183866-40183888 AAGTTTCTGGATAAGTGCAGTGG + Intronic
929346724 2:40893440-40893462 GAGATACTGCACATATGAAGAGG + Intergenic
930765331 2:55079405-55079427 AAGTTACTTGACAGATTCAGTGG - Intronic
934587596 2:95516867-95516889 AAGTGACTGGACAAATGCAATGG - Intergenic
935084529 2:99831930-99831952 GAGTTACAGGAGGAATGCAGAGG - Intronic
935963892 2:108453495-108453517 GAGTTGCAGGCCAAATGCAGTGG + Intronic
937962057 2:127467656-127467678 GAGTAACTGGGAAAATGAAGGGG - Intronic
938772238 2:134510604-134510626 GACTGACTGGACACAGGCAGAGG + Intronic
939014299 2:136884364-136884386 GAGGTGCTTGACAAATGCTGTGG + Intronic
939792488 2:146596135-146596157 GAGTTAGTGGCCAGGTGCAGTGG + Intergenic
940550778 2:155152996-155153018 GAGTGACTAGACAAATGCAAAGG + Intergenic
941708233 2:168682692-168682714 GAGTTGGTGGATAAATGCTGCGG + Intronic
941922355 2:170863870-170863892 CAGTTACTGGCCAGGTGCAGTGG + Intergenic
942338116 2:174913229-174913251 GTGATCCTGGAGAAATGCAGGGG + Intronic
942717842 2:178914588-178914610 GAGCCACTGGACAAAGGCAGTGG + Intronic
944079318 2:195769348-195769370 GAGTTGCTGGCCTAGTGCAGTGG - Intronic
944576476 2:201095735-201095757 GAGTTACAGGGCAGGTGCAGTGG - Intergenic
944824130 2:203464017-203464039 CAGTTACTTGACAAATTTAGGGG + Intronic
946487857 2:220117975-220117997 GAGGCAGTGGACAAATACAGAGG - Intergenic
948169133 2:235887216-235887238 GAGTCATTGGCCACATGCAGTGG + Intronic
948553191 2:238789455-238789477 TAGCCACTGCACAAATGCAGTGG - Intergenic
1168922540 20:1552471-1552493 GAATTTCTGTACAAATTCAGAGG - Intronic
1169426565 20:5501742-5501764 GAGGTACTGGAGAAAGGCTGTGG + Intergenic
1169847944 20:10015777-10015799 GAGTTAGTTGCCAAATGGAGTGG - Intronic
1179329860 21:40389434-40389456 GTGGTACTGGCCAAATACAGTGG - Intronic
1179997642 21:44981336-44981358 AAGGTGCTGGACAAAGGCAGGGG - Intergenic
952098936 3:29988894-29988916 GAGACACTGGACTAATGCACTGG + Intronic
952316293 3:32235522-32235544 GAGGTATTGAACAAATGCTGAGG - Intergenic
956583439 3:70839124-70839146 GAGTTAGTGCAAAAATGCAGGGG + Intergenic
957377029 3:79371719-79371741 GATTCACTGCACAAATTCAGGGG - Intronic
959215339 3:103445075-103445097 GAGTTTCTGGACGGGTGCAGTGG + Intergenic
959696546 3:109254646-109254668 AAGTAAATGGAAAAATGCAGTGG - Intergenic
959878349 3:111413267-111413289 GAGTTTCTGGACTAAAGCACAGG - Intronic
961593743 3:128000249-128000271 CAGCTACTGGCCAAGTGCAGTGG + Intergenic
963761533 3:149290768-149290790 GAATTACTGGAAAGATACAGAGG + Intergenic
966161689 3:176975457-176975479 TAGTTACTGGCCAGGTGCAGTGG + Intergenic
968566815 4:1317438-1317460 GAGGTGCGGGACAAATGCCGAGG - Intronic
968776382 4:2543371-2543393 AAGGTAGTGGCCAAATGCAGTGG - Intronic
969141318 4:5076484-5076506 GAATTACTAGACAAAAGCATAGG + Intronic
971509603 4:27407499-27407521 GAGTGAATGGACTAATACAGTGG + Intergenic
973970912 4:56213007-56213029 CAGTTGCTGCACAAAAGCAGTGG + Intronic
976077982 4:81321118-81321140 GAGTTACAGGCCAGGTGCAGTGG - Intergenic
976803471 4:89019471-89019493 GAGTTCCTGGCCAGGTGCAGTGG + Intronic
977692788 4:99934504-99934526 AAATTACTGGCCAGATGCAGTGG + Intronic
977801041 4:101231942-101231964 GAGTTACTGGTAATATTCAGTGG - Intronic
978653303 4:111034955-111034977 GAGTTACTAAACGAATGCAAGGG + Intergenic
982355700 4:154465379-154465401 GACATACTGGCCAAGTGCAGTGG + Intronic
983511148 4:168610734-168610756 GAGTTACTGGAAAAACTAAGAGG - Intronic
985662152 5:1162633-1162655 GAGGCACATGACAAATGCAGGGG - Intergenic
987271596 5:16314796-16314818 GACTTGAAGGACAAATGCAGGGG - Intergenic
989209567 5:38845966-38845988 GAGTTACTGGAAAACCGCGGGGG - Intronic
989387205 5:40865849-40865871 GAGATACTGGCCAGGTGCAGTGG + Intergenic
990681436 5:58249116-58249138 AAGTTTCTGGCCAAGTGCAGTGG + Intergenic
992356293 5:75987377-75987399 GAGTTACAGGTCAAAGGAAGGGG - Intergenic
993291874 5:86082686-86082708 AAGTTACTGGTCAGGTGCAGTGG + Intergenic
995313588 5:110740479-110740501 GAGTTCCTTGACACAAGCAGGGG + Intronic
996520397 5:124419783-124419805 GAGCAACTGGTCAAATGCAAAGG + Intergenic
997308176 5:132856054-132856076 GGGTTACTGGCCAGGTGCAGTGG - Intergenic
997380979 5:133437776-133437798 CATTTACTGGCCAAGTGCAGTGG - Intronic
997420925 5:133766121-133766143 GAATTACTGCATAAATGCAGGGG + Intergenic
998387366 5:141765245-141765267 GACTTACTGGTCAAAACCAGAGG + Intergenic
999025638 5:148228739-148228761 GATTTACTGGACAAAGTAAGAGG - Intergenic
999293019 5:150439800-150439822 GAGTTACTGGCCAGGTGAAGTGG - Intergenic
1004499325 6:16195893-16195915 GAGTGACTGGGGAAATGCATGGG + Intergenic
1004959378 6:20769128-20769150 GAGTTACGGGAAAAAGGCATAGG - Intronic
1005065536 6:21814226-21814248 GATTTACTTGCCAAAAGCAGAGG + Intergenic
1008903429 6:56649348-56649370 GAGTTACTGTCTAAATGCAGAGG + Intronic
1011213624 6:84981322-84981344 GAATGGCTGGAGAAATGCAGAGG + Intergenic
1011541904 6:88439899-88439921 AAGTTATTGGCCAGATGCAGTGG + Intergenic
1012176697 6:96095690-96095712 GAATTACTGGCCAAAGGCTGGGG - Intronic
1014926132 6:127272412-127272434 GACTAACTGGATAAATGCTGGGG - Intronic
1014932005 6:127346173-127346195 AAATTACTGGCCAGATGCAGTGG + Intergenic
1015404237 6:132819247-132819269 CAGCTTCTGGTCAAATGCAGTGG + Intergenic
1017826402 6:158085306-158085328 CAGTTACTGGCCAGGTGCAGTGG - Intronic
1020571261 7:9865686-9865708 GAGGTACTGGACTACTGCAATGG - Intergenic
1023793497 7:43772006-43772028 GAGGAACAGGACAAATGGAGAGG - Intronic
1028716406 7:93976010-93976032 AAGCTTCTGGACAAATGCTGAGG + Intronic
1030170106 7:106592598-106592620 TAGTAACTGAACCAATGCAGAGG - Intergenic
1033239779 7:139668272-139668294 GATTTACTGGCCGAGTGCAGTGG + Intronic
1034843951 7:154426144-154426166 GAGTAACAAGACAACTGCAGCGG - Intronic
1035127324 7:156617951-156617973 CAGTAACAGGCCAAATGCAGTGG + Intergenic
1037060734 8:14506327-14506349 GAGCTAATGTACAAATGGAGAGG - Intronic
1037819722 8:22129878-22129900 GAGTCCCAGGACAACTGCAGGGG + Intronic
1038113249 8:24523956-24523978 GAGCTGCTTGACAAATGCTGTGG - Intronic
1039860082 8:41449610-41449632 GAGTTCCTGGACAGGTCCAGTGG + Intergenic
1040579497 8:48685695-48685717 GAGTTACTGCACATCTGCACTGG + Intergenic
1040775763 8:51041640-51041662 GAGTCACTGGAGAAACCCAGAGG + Intergenic
1044023536 8:87138509-87138531 AACTTACTGCACAAACGCAGTGG + Intronic
1045797389 8:106061974-106061996 GAGTTAGTGGAAAAAGGTAGAGG - Intergenic
1050181000 9:2922875-2922897 GAATTACTGAACAAATGTAAGGG + Intergenic
1050207328 9:3210761-3210783 AAGTTCCTGGACAGGTGCAGTGG - Intergenic
1050645212 9:7712356-7712378 GAGTTGATTGACTAATGCAGAGG + Intergenic
1051195925 9:14562926-14562948 TAGTCTGTGGACAAATGCAGGGG - Intergenic
1051385604 9:16505253-16505275 CTGTTACTGGAAAATTGCAGTGG - Intronic
1053918915 9:42969337-42969359 GGGTTACTGGACCAAGGCACAGG + Intergenic
1056132288 9:83598541-83598563 GTGTTCCTGGAAAATTGCAGAGG + Intergenic
1056944085 9:90978995-90979017 GGGATACGGGACAGATGCAGGGG - Intergenic
1057574029 9:96226641-96226663 GAGTTACTGGCCAGGCGCAGTGG + Intergenic
1057946971 9:99338413-99338435 GGGATACTGGATAAATGAAGGGG + Intergenic
1186361158 X:8843372-8843394 CTGTTATTGGACAAATGCATTGG + Intergenic
1186834904 X:13428064-13428086 GAGGGACTGGTTAAATGCAGTGG - Intergenic
1188635409 X:32424566-32424588 GAGTTACTGCATAACTGCACAGG - Intronic
1189245158 X:39557683-39557705 GAGTTCCTGGGCAATTGGAGTGG - Intergenic
1189381155 X:40503267-40503289 GAAGTACAGGCCAAATGCAGAGG + Intergenic
1189629112 X:42933185-42933207 GGGTTAATGGAAAAATACAGAGG - Intergenic
1193358276 X:80549080-80549102 CATTTACTGGCCAAATGCAGTGG - Intergenic
1194935838 X:99947527-99947549 TGTTTACTGGAAAAATGCAGTGG + Intergenic
1196772220 X:119306048-119306070 AAGTTATTGGCCAAGTGCAGTGG - Intergenic
1197816226 X:130501326-130501348 GAGGTACAGGCCAGATGCAGTGG - Intergenic
1198625089 X:138562769-138562791 GTATTACTGGAGAAATGTAGGGG - Intergenic
1199367348 X:147002654-147002676 TATCTACTGGACAAATGCGGGGG - Intergenic
1199566194 X:149217788-149217810 GAGTTAATGGAGGAATCCAGTGG + Intergenic
1199918928 X:152375629-152375651 GGGTTTCTAGACAAATACAGTGG - Intronic
1199938566 X:152601720-152601742 CAGTTAATGGAAAAATGAAGAGG + Intergenic