ID: 1135409897

View in Genome Browser
Species Human (GRCh38)
Location 16:22225695-22225717
Sequence GGATACTGCTTGGGTAAAAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 99}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135409889_1135409897 10 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1135409889 16:22225662-22225684 CCTCTGCATTTGTCCAGTAACTC 0: 1
1: 0
2: 0
3: 22
4: 197
Right 1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG 0: 1
1: 0
2: 1
3: 2
4: 99
1135409888_1135409897 16 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1135409888 16:22225656-22225678 CCTTCGCCTCTGCATTTGTCCAG 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG 0: 1
1: 0
2: 1
3: 2
4: 99
1135409887_1135409897 26 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1135409887 16:22225646-22225668 CCTTGTAGGACCTTCGCCTCTGC 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG 0: 1
1: 0
2: 1
3: 2
4: 99
1135409892_1135409897 -3 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1135409892 16:22225675-22225697 CCAGTAACTCTGGCTGTGCCGGA 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG 0: 1
1: 0
2: 1
3: 2
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135409897 Original CRISPR GGATACTGCTTGGGTAAAAC GGG Exonic
905304858 1:37010582-37010604 GGAGACTGCTGGGGTAATCCTGG - Intronic
911031003 1:93488344-93488366 GGAGACTGCTTGGGTATACTGGG - Intronic
911550484 1:99273269-99273291 GGTTTCTGCCTGTGTAAAACTGG + Intronic
911664467 1:100538349-100538371 GGATGCTGCTTGGGAGAAGCGGG + Exonic
914874466 1:151502403-151502425 GGACTCTGCTTGGGAAAACCTGG - Intergenic
915866156 1:159501188-159501210 GGAGAGTGCTTGAGTAAAACAGG - Intergenic
917585371 1:176421279-176421301 TCATACTGCATAGGTAAAACTGG - Intergenic
919060969 1:192632295-192632317 GGAGACTCCTTTGGTAAAGCAGG + Intergenic
921900947 1:220450259-220450281 GGATACTGTTTAGGAAAATCAGG - Intergenic
1072233814 10:93436250-93436272 GGATACTGATTGGGTCAGAATGG - Intronic
1074614230 10:115050578-115050600 GAATACGGGCTGGGTAAAACAGG + Intergenic
1074885692 10:117691227-117691249 GGTTACTTCTTGGGTAGAGCAGG - Intergenic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1086676407 11:89612593-89612615 GGATAATGCTTGAATAAAAGAGG - Intergenic
1087132078 11:94677342-94677364 GGATAATGATGGGGTAAAAGGGG - Intergenic
1091573681 12:1713266-1713288 GTATAGGGCTTGGGTACAACTGG + Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1095135253 12:38593152-38593174 TGATACTGGTTGGATAAAATTGG + Intergenic
1096603244 12:52745618-52745640 AGTTACTGCATGGGCAAAACTGG + Intergenic
1096792025 12:54051448-54051470 GGCTACTGCTTGGTTAATAGTGG - Intronic
1097019036 12:56007366-56007388 GGAGACTGCTGGGGGAAAATGGG - Intergenic
1099482641 12:83188184-83188206 GGATGCTGCTGGGGTATTACAGG - Intergenic
1099928420 12:89045946-89045968 GGAAAGTCCTTGGGTAAATCTGG + Intergenic
1104164612 12:126215704-126215726 GGAAACTGCTTCAGTAAAAGTGG + Intergenic
1107177246 13:37413375-37413397 GGATACTGCCTGGGCAAAACAGG - Intergenic
1107674222 13:42777743-42777765 GAATACTGCTTGGCTGAATCAGG - Intergenic
1108848824 13:54704096-54704118 GTATAGGGGTTGGGTAAAACTGG - Intergenic
1109190428 13:59316239-59316261 GGATCATGCTTGGGTCAAGCTGG + Intergenic
1112160590 13:96863250-96863272 GAACACTGCTTGAGAAAAACTGG + Intergenic
1112623163 13:101073098-101073120 GGATGATGCTTGGGGAAGACAGG + Intronic
1114906162 14:27129466-27129488 GTAAATTGCTTGGGTAAAATAGG - Intergenic
1119738074 14:76996638-76996660 GGATTCTGCTGGGGTCAAAAAGG - Intergenic
1119801820 14:77452228-77452250 TGCTACTGCTTGTGTAAAAATGG + Intronic
1121316624 14:92964692-92964714 GGAGGCTGCTGGGGTCAAACAGG + Intronic
1121504239 14:94464107-94464129 GGATACTGTCTGGTTAAAAGGGG + Intronic
1129412540 15:75358131-75358153 GGAGACTGCTTGTGTGGAACAGG - Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1136101218 16:27997782-27997804 GGACACTGCTTGGGTAATGGGGG - Intronic
1137624377 16:49898497-49898519 GGCTGCTGCTTGGGTAGAAGAGG - Intergenic
1142580081 17:936539-936561 GGATTCTGCTGCGGAAAAACTGG + Intronic
1145102538 17:20088869-20088891 GGATTGTGCTTGTGCAAAACAGG + Intronic
1146521452 17:33528590-33528612 GAATAATGCTTGGGTAAAGGTGG + Intronic
1147192128 17:38744098-38744120 GGCTTCTGCTTGGGGAAAAGTGG - Intronic
1148447171 17:47744827-47744849 GGATACTGGTTGGGTAGGAGAGG - Exonic
1149832678 17:59885457-59885479 GGATACTGCTTTGGTCCCACGGG - Intronic
1157654129 18:49368834-49368856 GGAAACTGCTTGTGTTAGACAGG + Intronic
1157842258 18:50969159-50969181 GGATACTGATTTGGACAAACTGG - Intronic
1162739862 19:12767755-12767777 GTGTACTGTTTGGGTAGAACAGG - Intronic
1164070372 19:21762768-21762790 GAATAGGGCCTGGGTAAAACAGG + Intronic
1165048418 19:33124859-33124881 GGATACTGATTGGATCACACAGG + Intronic
929956144 2:46460188-46460210 GGTTTCTGCTTCTGTAAAACGGG - Intronic
930634703 2:53791444-53791466 GGATTCTGATTGTATAAAACAGG - Intronic
932451734 2:71814939-71814961 GGACAGTGCTTGGGTAAAAGAGG + Intergenic
936113817 2:109686254-109686276 GGACACTTCTTAGGTTAAACTGG + Intergenic
940054189 2:149496367-149496389 TCATACTGAATGGGTAAAACTGG - Intergenic
941768336 2:169323761-169323783 GATTACTTCTTGGCTAAAACTGG - Intronic
944961585 2:204880704-204880726 GGATACTTCTTGGAGATAACAGG - Intronic
948033840 2:234841740-234841762 GGATCATGCTTGGGTGAAGCAGG + Intergenic
1174105455 20:48159154-48159176 ATATTCTGCTTGGGGAAAACAGG + Intergenic
1179283966 21:39960215-39960237 TGATACTGGTGGGGTGAAACAGG - Intergenic
1179418526 21:41217454-41217476 GGAAGTTGCTTGGCTAAAACGGG - Intronic
1179476572 21:41650324-41650346 GGCTACTGGGAGGGTAAAACTGG + Intergenic
1180595228 22:16968577-16968599 GGACACTGTGTGGGTAACACTGG - Intronic
1181864323 22:25843498-25843520 GGATGATGTTTGGGAAAAACAGG + Intronic
1183487822 22:38098831-38098853 GGATTCTGCTTGGGAAAGTCAGG - Intronic
951346150 3:21548499-21548521 GGATTAAGCATGGGTAAAACTGG - Intronic
953924762 3:46977074-46977096 GGTTAGTACTTGGGCAAAACCGG - Intronic
960239373 3:115322511-115322533 GGATACTTCCTGGGTATAAGAGG - Intergenic
960643472 3:119852119-119852141 TGATACTGTTTTGGTAATACTGG + Intronic
972027836 4:34409237-34409259 TCATACTGAATGGGTAAAACTGG - Intergenic
974110386 4:57518954-57518976 TGATACTGAATGGGAAAAACTGG + Intergenic
976681044 4:87756191-87756213 TGATACTGAATGGGCAAAACTGG - Intergenic
978662826 4:111149142-111149164 TCATACTGAATGGGTAAAACTGG - Intergenic
982359803 4:154507224-154507246 TGATACTGCTTTGCAAAAACAGG + Intergenic
986649745 5:9951209-9951231 GGATATTGCATGGGGAAAAGTGG - Intergenic
992037251 5:72792323-72792345 GGAAACTGCTTAGGGCAAACCGG - Intergenic
992481804 5:77158904-77158926 GTATACTCCTTAGGTAACACAGG + Intergenic
998524297 5:142828317-142828339 GGAAACTGCACGGGTAAAAGTGG - Intronic
999556414 5:152747476-152747498 TGATACTGATTGGGCAAAAGAGG - Intergenic
1000437081 5:161225390-161225412 GCATACTGAATGGCTAAAACTGG - Intergenic
1001162590 5:169334200-169334222 GGAAACTGCATGGGGCAAACAGG - Intergenic
1001445549 5:171779902-171779924 GGATAGTGCCTGGCTCAAACTGG - Intergenic
1007807729 6:44463057-44463079 TGTTACTGCTTGAGTAAAAGGGG + Intergenic
1010713968 6:79207043-79207065 AGTTACTTCTTGGGTAAAATGGG - Intronic
1010778013 6:79908984-79909006 AGTTTCTGCTTGGGTCAAACAGG + Intergenic
1012579990 6:100855637-100855659 GGAAACTGCTTAGGTAAGTCAGG - Intronic
1013390971 6:109686120-109686142 GGAGAGTCCTTGGGTAAGACTGG - Intronic
1016633624 6:146260948-146260970 AGATACTGCTTGGCAAAAGCCGG + Intronic
1030274495 7:107705516-107705538 GAAGACTTCTTGGTTAAAACAGG - Intronic
1035140238 7:156752395-156752417 GGATACAGTTGGGGAAAAACTGG + Intronic
1042567663 8:70128892-70128914 GCATACTGCTGTGGGAAAACGGG + Exonic
1045398162 8:101782959-101782981 GGATACTGCATGAGTAATATAGG - Intronic
1045496953 8:102717120-102717142 GGATAATTCTTGGTTACAACTGG + Intergenic
1056073034 9:83008417-83008439 GGATACGGCTTGGGGAAAGGTGG - Intronic
1057772271 9:97979165-97979187 GGATGCTGCTTGGGTAAGGAAGG + Intergenic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1061818718 9:133210811-133210833 AGATACTGGTTGGGTTCAACTGG + Intergenic
1188230043 X:27650894-27650916 TCATACTGCATGGGAAAAACTGG - Intronic
1188343328 X:29032369-29032391 GGATTCTGCTTAGGTAGATCTGG - Intronic
1191692591 X:63956321-63956343 GTATACTGCTTGGGTAATGGGGG + Intergenic
1195015464 X:100775276-100775298 GTATACTGCTCAGGTAAAATGGG + Intergenic
1198796006 X:140395470-140395492 CCATACTGCTTGGGGAAAAATGG + Intergenic
1199667356 X:150108598-150108620 TGAAACTGTTTGGGTAAAATTGG + Intergenic