ID: 1135410255

View in Genome Browser
Species Human (GRCh38)
Location 16:22228751-22228773
Sequence AAGCTGGACAGCTCGAGCTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135410254_1135410255 -10 Left 1135410254 16:22228738-22228760 CCAGTCAACTTTGAAGCTGGACA No data
Right 1135410255 16:22228751-22228773 AAGCTGGACAGCTCGAGCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135410255 Original CRISPR AAGCTGGACAGCTCGAGCTT CGG Intronic
No off target data available for this crispr