ID: 1135415548

View in Genome Browser
Species Human (GRCh38)
Location 16:22265845-22265867
Sequence TCCCCTTGCTTTCCTCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 319}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135415548_1135415557 30 Left 1135415548 16:22265845-22265867 CCTTGCAGAGGAAAGCAAGGGGA 0: 1
1: 0
2: 3
3: 32
4: 319
Right 1135415557 16:22265898-22265920 TGGTGCCTTATATGGGGAGCTGG No data
1135415548_1135415555 23 Left 1135415548 16:22265845-22265867 CCTTGCAGAGGAAAGCAAGGGGA 0: 1
1: 0
2: 3
3: 32
4: 319
Right 1135415555 16:22265891-22265913 AGTCTTCTGGTGCCTTATATGGG No data
1135415548_1135415556 24 Left 1135415548 16:22265845-22265867 CCTTGCAGAGGAAAGCAAGGGGA 0: 1
1: 0
2: 3
3: 32
4: 319
Right 1135415556 16:22265892-22265914 GTCTTCTGGTGCCTTATATGGGG No data
1135415548_1135415553 10 Left 1135415548 16:22265845-22265867 CCTTGCAGAGGAAAGCAAGGGGA 0: 1
1: 0
2: 3
3: 32
4: 319
Right 1135415553 16:22265878-22265900 GGTCTGAAGTGGGAGTCTTCTGG No data
1135415548_1135415554 22 Left 1135415548 16:22265845-22265867 CCTTGCAGAGGAAAGCAAGGGGA 0: 1
1: 0
2: 3
3: 32
4: 319
Right 1135415554 16:22265890-22265912 GAGTCTTCTGGTGCCTTATATGG No data
1135415548_1135415551 -1 Left 1135415548 16:22265845-22265867 CCTTGCAGAGGAAAGCAAGGGGA 0: 1
1: 0
2: 3
3: 32
4: 319
Right 1135415551 16:22265867-22265889 ATTTGCTGGAAGGTCTGAAGTGG No data
1135415548_1135415552 0 Left 1135415548 16:22265845-22265867 CCTTGCAGAGGAAAGCAAGGGGA 0: 1
1: 0
2: 3
3: 32
4: 319
Right 1135415552 16:22265868-22265890 TTTGCTGGAAGGTCTGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135415548 Original CRISPR TCCCCTTGCTTTCCTCTGCA AGG (reversed) Intronic
901221248 1:7585254-7585276 ACCCCTTCCTTTACTCTGCCTGG - Intronic
901236662 1:7670890-7670912 TCCCCTCTCTGTTCTCTGCAGGG + Exonic
902113989 1:14106259-14106281 ATCCCTTTGTTTCCTCTGCAAGG - Intergenic
902779101 1:18693104-18693126 TTCCCTGGCTGTCTTCTGCATGG + Intronic
902904987 1:19549892-19549914 TCCACTTGGTTTCCTTTACAAGG + Intergenic
903330611 1:22595209-22595231 AACCCTGGCTTTCCCCTGCAGGG + Exonic
903713916 1:25348843-25348865 TCCACTTCCTTTCCTCTTCCTGG + Intronic
903968823 1:27106086-27106108 ACCCCCTGCCTTCCCCTGCAGGG - Exonic
904600815 1:31671658-31671680 TTCCCTTGGCTTCCTTTGCAGGG - Exonic
904603930 1:31688868-31688890 TCCCCTGGCTTTGGTCTGCCTGG - Exonic
905455159 1:38083596-38083618 AGCCCTTGTTATCCTCTGCAGGG - Intergenic
906586472 1:46983437-46983459 TGCCCTTGCTGTCCTCTGGCTGG - Intergenic
907589217 1:55650161-55650183 TCCAGCTGCTTTCCTCTGGATGG + Intergenic
910455020 1:87388461-87388483 TCCCCTGACTTTCCTCAGGAGGG + Intergenic
910927617 1:92412777-92412799 TCCCTTTCCCTTTCTCTGCAAGG + Intergenic
913715494 1:121530163-121530185 TATCTTTGCTTTCCTCTCCAGGG - Intergenic
915215869 1:154340499-154340521 TTCTCTTGTTTTTCTCTGCATGG + Intronic
917120535 1:171641357-171641379 TCCCCTTTCTTTCCTTCCCATGG - Intronic
917670959 1:177273146-177273168 GCCTCTTGCCTTCCTCTGGAGGG + Intronic
918047483 1:180950319-180950341 TTCTCCTGTTTTCCTCTGCAGGG + Exonic
919660777 1:200243336-200243358 AGCCCTTTCTTTGCTCTGCAGGG - Intergenic
919669225 1:200323766-200323788 TCCCCTTCCTCTCCTGTGGAAGG + Intergenic
920825846 1:209423778-209423800 TCCCCTTTCTATCTTCAGCAGGG + Intergenic
922582677 1:226710434-226710456 TTTCCTTCCTTTCTTCTGCAGGG + Intronic
923857127 1:237857329-237857351 TGCCCTTGTTTTCCCCTGGAAGG + Intergenic
924625389 1:245693134-245693156 TTCCCTTGCTTTCCTTTTCTTGG + Intronic
924856374 1:247879027-247879049 TCCCTCTCCTTTCCTCTGAATGG + Intergenic
1064124734 10:12650225-12650247 TTCCTTTGCCTTCCTGTGCAGGG + Intronic
1064893677 10:20209318-20209340 TCTCATTGTTTTCCTCAGCAAGG - Intronic
1065295004 10:24265948-24265970 TCCCCTTCCTTTCCTTTAAAGGG - Intronic
1065360207 10:24882280-24882302 TCCCCCTGGCTTCCTCTGCATGG + Intronic
1066034471 10:31467840-31467862 TAGCCTTGCTTTCTGCTGCAGGG + Intronic
1066529993 10:36327110-36327132 TACCCTTGCTTCTTTCTGCAGGG - Intergenic
1067443364 10:46325696-46325718 TCCTCCTGCTTTGGTCTGCAGGG + Intronic
1070160945 10:73866362-73866384 TGCCCTTTCCTTCCTCTGCCAGG + Intronic
1070773058 10:79093769-79093791 TGCCCTTGCGTGCCTCTTCAGGG + Intronic
1070971072 10:80567768-80567790 TCCCCTTGGCCTCCTCTGAAGGG + Intronic
1071515100 10:86291895-86291917 TGCCCTTGATTTCCTCTGTCAGG - Intronic
1073448932 10:103598041-103598063 ATCCATTGCTTTCCTCAGCAAGG - Exonic
1073485117 10:103812339-103812361 TCCCCCTGATTTCCATTGCAAGG - Intronic
1074419648 10:113297833-113297855 TCCATTTTCTTTCCTCTGAAGGG + Intergenic
1074551902 10:114451549-114451571 TCTCCTTGCTGTCCTCTGAAAGG - Intronic
1075159270 10:120009082-120009104 TCTCTTTGCTTCCCTGTGCAGGG + Intergenic
1076803086 10:132841537-132841559 TCCCGTGGCTTTGCTCTGCTGGG + Intronic
1076809823 10:132880635-132880657 TCTCAGTGCTGTCCTCTGCAGGG - Intronic
1076809830 10:132880670-132880692 TCTCAGTGCTGTCCTCTGCAGGG - Intronic
1078520356 11:12057867-12057889 TCCCCTTGCCTCCCTCTCCCAGG - Intergenic
1078755529 11:14205117-14205139 TCCCTTTTCTCTTCTCTGCATGG + Intronic
1078822210 11:14893623-14893645 TCCCCATTCCTTCCTCTTCAAGG + Intergenic
1079407939 11:20161715-20161737 TCCCTTCGCTTTCCTCTGGTTGG + Intergenic
1081578788 11:44337299-44337321 TTCCCCTGTTTTCCTCTTCATGG - Intergenic
1081619442 11:44610565-44610587 TGACCCTGCTGTCCTCTGCATGG - Intronic
1081664901 11:44911043-44911065 TCCGCCTGCTTTCCTGTGCTGGG + Intronic
1082820667 11:57542729-57542751 TGCCTTTGGTCTCCTCTGCAGGG - Exonic
1083793705 11:65002286-65002308 AGCCCTTGCTTTCCTGTCCACGG - Intergenic
1084576610 11:69992755-69992777 TCCCCGTGCCTGCCTCTGCCTGG + Intergenic
1084903724 11:72329773-72329795 TCCCATTTCATTCCTCTGCAGGG + Exonic
1085776802 11:79373921-79373943 AACACTTGCTTTCCTCTGCCTGG - Intronic
1085958071 11:81425369-81425391 TACCCTTGCTTACCTCTCCTTGG - Intergenic
1086245467 11:84746815-84746837 TGCCCTGGCCTTCCTCTGCATGG + Intronic
1086449755 11:86904416-86904438 TCCCTTGGCTTTCCTTTGCCTGG + Intronic
1088124602 11:106408742-106408764 TCCTCTTGCTTTCCCCTCCAGGG + Intergenic
1088457142 11:110044614-110044636 TCCCCTTGCTCTCCGCACCAAGG + Intergenic
1089326013 11:117657610-117657632 CCCCCATGCTTTCATCTACATGG + Intronic
1090325986 11:125887091-125887113 AGCTCTTCCTTTCCTCTGCATGG - Exonic
1090703565 11:129316615-129316637 ACCCCTTTCTTTCCTTTCCAGGG + Intergenic
1093787612 12:23210793-23210815 GCCCCTCGCTGTCATCTGCAAGG + Intergenic
1095527357 12:43143147-43143169 TGCACTTGCTGTTCTCTGCATGG + Intergenic
1096849239 12:54425064-54425086 TCCCCTTGCCTTTCTCTTCAGGG + Intergenic
1097347281 12:58507174-58507196 TCTCCATACTTTCCTCTGCTGGG - Intergenic
1097915254 12:65014190-65014212 CTCACTTTCTTTCCTCTGCAGGG + Intergenic
1100477576 12:94948622-94948644 TTCCCTTGCTCTGCTCTGTATGG - Intronic
1102096667 12:110246747-110246769 TCCCCTGGCTTGCCTCTCCCTGG + Intergenic
1102235725 12:111293438-111293460 TCCCCTCTCTCTGCTCTGCAGGG - Exonic
1102678199 12:114672724-114672746 TCCCCTTGGTTACCTCTGTGGGG - Intronic
1103915828 12:124375181-124375203 ACCCCTGGCCTTCCTCTGCCTGG + Intronic
1104053512 12:125212020-125212042 TCACCTTTCTTCCCTCTTCAGGG + Intronic
1104316561 12:127708585-127708607 TCACCATGTTTTCCTCTCCAGGG + Intergenic
1104435029 12:128748873-128748895 TGCCCTTGCCTTGCTCTGGAGGG + Intergenic
1104617309 12:130281467-130281489 ACCCCTTTCTTCCCTCTGGAGGG + Intergenic
1104973427 12:132541527-132541549 TCCACTTCCCTTCCCCTGCATGG - Intronic
1106609456 13:31264459-31264481 TCCTCTCCCTTTCCTCTGCCAGG + Intronic
1106925834 13:34612236-34612258 TTCCCTTGTTTTCTTCTGCCTGG + Intergenic
1108341015 13:49497851-49497873 TCCATTTGCTATTCTCTGCAAGG + Intronic
1108590867 13:51911949-51911971 TCCCGCTTCTTTCCTCTGCCTGG + Intergenic
1109207796 13:59501066-59501088 TCCCCTTGTTTTCTTCTCAAAGG - Intergenic
1109280957 13:60354798-60354820 TCTACTTTCTCTCCTCTGCAAGG + Intergenic
1110807344 13:79771946-79771968 TCCTCATGCTTACCCCTGCATGG + Intergenic
1111018635 13:82415975-82415997 TTATCTTGCTTTCCTCTTCAGGG + Intergenic
1113291999 13:108917384-108917406 GCCCTGTGCTTTCCCCTGCATGG + Intronic
1113421861 13:110177036-110177058 TGCCTTCTCTTTCCTCTGCAGGG - Exonic
1113714285 13:112492467-112492489 TGCCCTCGCTTGCATCTGCATGG - Intronic
1114596536 14:23917126-23917148 TCCCCTTGCTGTTCTGTGCTTGG - Intergenic
1115109634 14:29806076-29806098 TTGCCTTGCTTTCCTCTCCTGGG - Intronic
1115222238 14:31069568-31069590 TTCCTTTGCTTTGCTCTGCGTGG - Intronic
1116791889 14:49348116-49348138 TCTCCCTGCCTTCCTCTCCAAGG + Intergenic
1117443735 14:55782980-55783002 TCCCCTTTCTTTCCTCTTCAAGG - Intergenic
1118362834 14:65070444-65070466 TTCCTTTGCTGTCCTTTGCAGGG - Intronic
1119032595 14:71204324-71204346 TCCCCTTTCTTTCCTCTCAATGG - Intergenic
1119111997 14:71983547-71983569 TCCCCTTTCTTGCCTCTTCCAGG + Intronic
1120009447 14:79396832-79396854 TCTCCAAGATTTCCTCTGCAAGG - Intronic
1120627694 14:86849408-86849430 TTCCATTCATTTCCTCTGCATGG + Intergenic
1122767543 14:104082415-104082437 ACACCTTGCTTCCCTCTGCCTGG + Intergenic
1123834040 15:24169707-24169729 TCCTCCTCCTTTCCTCTGCAGGG - Intergenic
1123840767 15:24244747-24244769 TCCTCCTTCTTTCCTCTGCAGGG - Intergenic
1123849829 15:24343272-24343294 TCCTCCTCCTTTCCTCTGCAGGG - Intergenic
1123853722 15:24385250-24385272 TCCTCCTTCTTTCCTCTGCAAGG - Intergenic
1123869688 15:24557867-24557889 TCTTCCTTCTTTCCTCTGCAAGG - Intergenic
1126087558 15:45023721-45023743 CCCCCTTTCTCTGCTCTGCACGG - Intronic
1126574585 15:50184304-50184326 TCTTATTGTTTTCCTCTGCATGG + Intronic
1126809213 15:52383704-52383726 TCAGCTTGCTGTCCTGTGCATGG - Intronic
1127364272 15:58272713-58272735 TCCAGTAGATTTCCTCTGCATGG - Intronic
1129598399 15:76982698-76982720 TCCCCTTTTTTTCCTCTCCCAGG - Intergenic
1130022275 15:80241579-80241601 CTCCTTTGCTTTGCTCTGCAGGG + Intergenic
1131103408 15:89712763-89712785 TCCCCTTCCCATCCTCTGTAAGG + Intronic
1131440118 15:92453610-92453632 TGGCCTTGCTTTTCTCTGCCTGG + Intronic
1131718005 15:95134512-95134534 AACCCTTGCTTTCATCTCCAGGG - Intergenic
1131770721 15:95734621-95734643 TGCACTTGCTTTCCTCAGCGGGG + Intergenic
1132220432 15:100101119-100101141 CCCTCTTGCTTCCCTCTGCCTGG + Intronic
1132517965 16:374628-374650 TGCCCCTGCATTGCTCTGCAAGG + Intronic
1133066901 16:3214407-3214429 AGCCCTTGCTTTCCTCTGCCTGG - Intergenic
1134046463 16:11104557-11104579 TCCCTTGGATTTCCTCTGTAAGG - Intronic
1135415548 16:22265845-22265867 TCCCCTTGCTTTCCTCTGCAAGG - Intronic
1135813918 16:25614720-25614742 TCCCCTCCCCCTCCTCTGCAGGG + Intergenic
1136265993 16:29118792-29118814 CCCCCATGCTTCCCTCTGCTGGG + Intergenic
1136608865 16:31354371-31354393 TCCCCTTGCTTTCCTCCCAGTGG + Intergenic
1138120772 16:54399390-54399412 CCCCCTTCCTTTGCTCTTCAAGG - Intergenic
1138597090 16:58034891-58034913 CTCCCTTGCTTTCCTCCCCAGGG + Intronic
1139546031 16:67649984-67650006 TTCCCTTGCCCTTCTCTGCACGG + Intronic
1139973091 16:70788434-70788456 GCCCCTTGCTTTCGTCTTTATGG + Intronic
1141935135 16:87233543-87233565 TCCACATGCTTTCATCTGCAGGG - Intronic
1142054803 16:87986700-87986722 CCCCCATGCTTCCCTCTGCTGGG + Intronic
1146373718 17:32280910-32280932 TGCCCTTGCTTTCATCTTCCTGG + Intronic
1147214186 17:38889967-38889989 CCCCCTTGCTCTCCTCTGCATGG + Intronic
1149387587 17:56157164-56157186 TCCCTTTGCTGTCCCCTGCCAGG - Intronic
1149874618 17:60218979-60219001 TCCCCTTTCATTTCTCTGTAAGG - Intronic
1152087727 17:78230992-78231014 TGGCCATGCTTTCCTCTGCTAGG - Intergenic
1152348597 17:79770169-79770191 TCCCTTTGCTTTCCTGTGGCTGG + Intergenic
1153412281 18:4807258-4807280 TCTCCCTGCTTGCCTCTGCTGGG - Intergenic
1153722580 18:7922058-7922080 TTCCCTTTTTTTCCTCTGCTAGG + Intronic
1155355204 18:24945229-24945251 TCTTCTTGCTCTCCTCTGCGGGG - Intergenic
1156257282 18:35410241-35410263 TCCCTTTTCCCTCCTCTGCATGG - Intergenic
1156314001 18:35950494-35950516 TCCCCTCGCTTCCCTTTGCTTGG + Intergenic
1156945132 18:42820566-42820588 TCCCCTGGCTTTCTTCTTAATGG + Intronic
1157724354 18:49952351-49952373 GGCCCTGGGTTTCCTCTGCAGGG + Intronic
1159997536 18:74980808-74980830 CTCCCTTTCTTTCCTCTGCTGGG - Intronic
1161735966 19:5992171-5992193 GCCCATTGCTCTCCTCTGTAGGG + Intergenic
1162499452 19:11043455-11043477 TCCACTTGCTTTCCTCTTTGAGG - Intronic
1163792451 19:19315629-19315651 TCCCCTTCCTGCCCTCTGCTGGG + Intronic
1163795155 19:19333749-19333771 TCGCCTTGCTTACCTCTGCTGGG + Intronic
1164562153 19:29299777-29299799 ACCTCTTCCTTTCCTCTGCATGG - Intergenic
1164576572 19:29408775-29408797 TCCCCTCCCTTTGTTCTGCAAGG + Intergenic
1164755435 19:30685714-30685736 TCCCCCTGGTTGCCTCTGCACGG - Intronic
1164821587 19:31255274-31255296 TCTGCTTGCTACCCTCTGCAGGG + Intergenic
1165487636 19:36105000-36105022 CCCCCGTGCCTTCCTCCGCACGG - Exonic
1165488688 19:36110928-36110950 TCCCCTTGCCTGGCTCTGCTTGG + Intergenic
1167830934 19:52022274-52022296 TCCTCTTGAGTTCCTCTGCCCGG + Intronic
925197297 2:1936686-1936708 TCAACTTGCTTTCCTCATCAGGG + Intronic
925472722 2:4180009-4180031 TCCCTCTGCTTTCTACTGCATGG + Intergenic
926561047 2:14417864-14417886 TCCCCTTGCTCTTCACCGCATGG - Intergenic
926977725 2:18531941-18531963 TCTCCCTGCTTACCTCTGCCTGG + Intergenic
927550358 2:23992949-23992971 TCCTCCTGTTTTACTCTGCAAGG + Intronic
927695009 2:25233852-25233874 TCTCCCACCTTTCCTCTGCAAGG + Exonic
927933253 2:27059305-27059327 TCCCCCAGCTTTCCTTTTCATGG + Exonic
929126780 2:38529565-38529587 TCAACGTGCGTTCCTCTGCAGGG - Intergenic
929588257 2:43129609-43129631 TCCCCTTTCCCTTCTCTGCAGGG + Intergenic
930712770 2:54564637-54564659 CCCTCTTGGTTTCTTCTGCAGGG + Intronic
931613000 2:64124125-64124147 TCCCCTTTCTTTCCCCTCCCAGG - Intronic
932214919 2:69960510-69960532 CCCCTTTGCCTCCCTCTGCAGGG - Exonic
933900303 2:86844958-86844980 CGCCCTTGCTTTCCTCTTCCAGG - Exonic
934293771 2:91723986-91724008 TCCCCCGGCTTTCCTCAGCCTGG - Intergenic
934550645 2:95259437-95259459 TCACCTGGCTTTCTTCTCCATGG - Intronic
934616726 2:95775919-95775941 TCCCATTCCCTTCCCCTGCATGG + Intergenic
934644164 2:96048641-96048663 TCCCATTCCCTTCCCCTGCATGG - Intergenic
934837579 2:97604732-97604754 TCCCATTCCCTTCCCCTGCATGG - Intergenic
935277380 2:101486596-101486618 TGCATTTGATTTCCTCTGCAAGG + Intergenic
935531474 2:104237833-104237855 TACCCTTGCTATCCTTTTCATGG + Intergenic
935780245 2:106504267-106504289 CGCCCTTGCTTTCCTCTTCCAGG + Intergenic
936866842 2:117084570-117084592 TCCCCTAGCTTCCTTCTGCAAGG - Intergenic
937005017 2:118503477-118503499 TGCACTTGATTTCCTCTGCTTGG - Intergenic
937257644 2:120566299-120566321 TCCCCATGCCTTCCTCTTCCAGG + Intergenic
938077108 2:128345900-128345922 ACCCCTTGCCTTCCTCCACAGGG + Intergenic
945119680 2:206444124-206444146 GCCCTTCGCTTTCCTCTGCAGGG - Intronic
945643265 2:212458242-212458264 TCCCCTTGGCTGCCTTTGCATGG - Intronic
945945131 2:215988270-215988292 ACCCCTTGCTTTTCTCTGTGAGG - Intronic
947872922 2:233449741-233449763 ATCCCTTGCCTTCCCCTGCAAGG + Intronic
948258291 2:236584298-236584320 TTCCTTTGATTTCCACTGCAGGG + Intergenic
1169961241 20:11162447-11162469 TGCCCTTTCATTCCTTTGCATGG + Intergenic
1170916416 20:20631008-20631030 TCCCCTCCCTTTCATCTACATGG + Intronic
1171442693 20:25178120-25178142 TCCCTTTGCTTCCCTGTGCTTGG - Intergenic
1172269231 20:33644263-33644285 GCCCCTTGCTTTACTGTGCAGGG + Intronic
1173311463 20:41899854-41899876 TTCCCTTGTTATACTCTGCAAGG + Intergenic
1173573016 20:44090275-44090297 GCACCTTCCTTTTCTCTGCAGGG - Intergenic
1173911494 20:46674296-46674318 TCCCCCTTCTTTCCCCTGGAGGG + Intronic
1174689870 20:52493252-52493274 TCTCCTTGCTTTCAACTGCCAGG - Intergenic
1174724061 20:52842910-52842932 TCCCCCATCTTTCCTTTGCAAGG + Intergenic
1174952069 20:55053033-55053055 TCCATTTTCTTTCCTATGCATGG + Intergenic
1175319370 20:58074556-58074578 TCCCCTTCCCGTACTCTGCAAGG + Intergenic
1175414384 20:58792292-58792314 TCAACTTGCTTTCCTCTGCAGGG + Intergenic
1175713170 20:61237270-61237292 GCCCCTTGCTTCCCTTTGAATGG + Intergenic
1176212741 20:63932934-63932956 TCCCCCTGCTCCCCTATGCAGGG - Exonic
1176885128 21:14246113-14246135 TCTCCATGCTTTCTTCAGCAGGG + Intergenic
1177991045 21:28036825-28036847 GCCCCCTGCTTTCCTCAGAAAGG - Intergenic
1179918808 21:44495945-44495967 TCCCTTTGCTTTCCGCAGAAGGG - Intergenic
1180937342 22:19634439-19634461 TCCCCTTGGTTTCCTGAGCTAGG - Intergenic
1182482851 22:30620900-30620922 TCCCATTCCTTAACTCTGCAGGG - Intronic
1182998003 22:34832055-34832077 TCCCCTTCCTCTGCTCTGCCTGG - Intergenic
1183076803 22:35432557-35432579 GGCCCTTGCTTTCCTCCCCAAGG - Intergenic
1183215067 22:36474106-36474128 GCCCCTGGCTTTCCCCTGCCTGG - Intronic
1184160998 22:42697375-42697397 GCCCCTGTCTTTCTTCTGCAGGG + Intronic
1184398655 22:44260837-44260859 TCCCCATGGTTGCCCCTGCATGG + Intronic
1184931280 22:47682974-47682996 TCCCCTTGCTGTCCTTTCCCGGG - Intergenic
1185228167 22:49665012-49665034 GCTCCTTGCTCTCCTCTGCTTGG - Intergenic
1185312398 22:50163279-50163301 TTCCCTTGCCTTGCTTTGCAGGG - Intergenic
1203314921 22_KI270736v1_random:180120-180142 TTCCCTTCCTTTCCTTTGAAAGG - Intergenic
950637335 3:14324273-14324295 TCCCCTCGATTTCCCCTGCCTGG + Intergenic
953869039 3:46610164-46610186 CCCCCTTGCTTGCATCTGCTTGG + Intronic
954711538 3:52507457-52507479 TGCCCCTGCTCTCCTCTGCCTGG + Intronic
954841606 3:53516425-53516447 TCCCTTCCCTTTCCTCAGCAAGG + Intronic
954898095 3:53994690-53994712 TCCTCATCCTTCCCTCTGCAAGG - Intergenic
956633004 3:71334431-71334453 TTCCTTTGCTTTCCTCTCCAGGG - Intronic
956971380 3:74530745-74530767 TACCCTAGCTTTCCTCTGTGAGG - Intergenic
959813460 3:110646940-110646962 TCCCCATTCTTTCCTCTCCTTGG - Intergenic
961750499 3:129091345-129091367 TGCCCCGGCTTTCCTCCGCAGGG - Exonic
962281372 3:134054432-134054454 TCCCCTTACTCTGCTCTGCCTGG - Intergenic
966227438 3:177612974-177612996 TAACCTTGCCTTCCTATGCATGG + Intergenic
966839625 3:184077991-184078013 TCACGTTGTTTTTCTCTGCAGGG + Intergenic
967986176 3:195097049-195097071 TCCCCTGGCGTCCCTCTGCTGGG + Intronic
1202739030 3_GL000221v1_random:37784-37806 TCTCCTTGCCTCCATCTGCAGGG + Intergenic
968783452 4:2600676-2600698 TCTCCTCTCTTTCCTCTCCAAGG + Intronic
969183117 4:5456910-5456932 CCCCCTTACCTTCCTCAGCAGGG - Exonic
969213791 4:5707879-5707901 TCCCAGTGCTGGCCTCTGCAAGG + Intronic
969447730 4:7255199-7255221 TACACTTGCCTTCTTCTGCATGG - Intronic
969707254 4:8818752-8818774 TACCCTTGCTCTCCCCTGCCAGG - Intergenic
971781538 4:31041374-31041396 TCACCTTGCTTTCTTCTACTTGG + Intronic
972555549 4:40177265-40177287 CTCCCTTCCTTCCCTCTGCATGG - Intergenic
972712219 4:41608966-41608988 TTCCCTTGCTTTTCTGGGCAAGG - Intronic
973229311 4:47823831-47823853 TGCCCTGGCTCTCCTATGCATGG + Intronic
975857649 4:78641621-78641643 TCCCTTTGTTGTCATCTGCACGG + Intergenic
976648388 4:87409212-87409234 TATCCTTGCTTTCCTCTTCAAGG + Intergenic
978305545 4:107323883-107323905 ACCCCTTCTGTTCCTCTGCATGG + Intergenic
983034227 4:162842656-162842678 TCCCCTTTCCTTCAACTGCAAGG + Intergenic
985548721 5:522801-522823 TCACCCTGCTTTCCTCTGACGGG - Intronic
985857849 5:2444308-2444330 TCCCATCTCTTTCCTCTTCAGGG + Intergenic
989698218 5:44230230-44230252 TCCCCTGACTTGCCTCAGCAGGG + Intergenic
991684076 5:69165976-69165998 TACCCTTGCTCTCCTCTGCCTGG - Intergenic
992625210 5:78630630-78630652 TCCCCGTGGTTTCTTCTGCTTGG - Intronic
993131925 5:83908959-83908981 TTCTCCTGCTTTCCTCTTCAAGG - Intergenic
995844148 5:116476005-116476027 TACCCTTGCCTTCCTAGGCAAGG + Intronic
997202561 5:132020647-132020669 TGCCCTTGGTTTCCTCAGCAGGG + Intergenic
997405284 5:133640979-133641001 TGCTCTTGCTTTCCTTGGCAGGG + Intergenic
998377856 5:141702840-141702862 TCCCACTCCTTTCCTCGGCAGGG - Intergenic
998445708 5:142196847-142196869 GTTCCTTGCTTTCCCCTGCAAGG - Intergenic
999480618 5:151944838-151944860 TCCCTTTCATGTCCTCTGCAGGG - Intergenic
1000409478 5:160922941-160922963 TCCTATTTCCTTCCTCTGCAGGG - Intergenic
1001117582 5:168952624-168952646 TGCCCTTTCTTTCTTCTTCATGG - Intronic
1001163275 5:169340342-169340364 GCCTCTTTCTTTCATCTGCAGGG + Intergenic
1001518477 5:172373814-172373836 CCCCCTTTCTTTCCTGTACAGGG - Exonic
1001880874 5:175243085-175243107 TACCTTTTCTTTCCTCAGCATGG - Intergenic
1002551345 5:179995140-179995162 TGCCCTTGCCTTCCTGTGCTGGG - Intronic
1003386950 6:5677650-5677672 GCCCCTTGCTTGGCTTTGCATGG - Intronic
1003432266 6:6050467-6050489 TCCCTCTGCTTGCTTCTGCAGGG + Intergenic
1003501250 6:6704739-6704761 TCCTCTTGCTTTCAACTACAGGG - Intergenic
1003561394 6:7183682-7183704 TCCCCCTCCTTTCTTCTCCAGGG + Intronic
1004173403 6:13316854-13316876 CCCCCTTGCTCCCCTCTTCAGGG - Intronic
1004694944 6:18024844-18024866 TCCCCTTGCTCACCCCTGGAAGG - Intergenic
1004980004 6:21012697-21012719 GCCCCTGGCTTTCCTCTGTGAGG + Intronic
1007079564 6:39089573-39089595 TCCCATTTCTTTCTTCCGCAAGG + Intergenic
1007307907 6:40921492-40921514 TCCCCCTTCCTCCCTCTGCAGGG - Intergenic
1007343238 6:41207272-41207294 TCCACTTGCCTTCCCCTCCAAGG - Intergenic
1007346974 6:41238244-41238266 TCCACTTGCCTTCCTCTCCGAGG + Exonic
1007803997 6:44423743-44423765 TCTACTTTCTTTCTTCTGCATGG + Intronic
1008381942 6:50846273-50846295 CCCCCTTGCTTTCCTTAGCCAGG + Exonic
1008479027 6:51965311-51965333 TGCACTTGATTTCCCCTGCAAGG - Intronic
1010792190 6:80077465-80077487 TCCACTTGCTTTCTTGTGAAGGG + Intergenic
1013355141 6:109339845-109339867 TCCTCCTGCCTTCCTCTCCAGGG + Intergenic
1013893133 6:115050160-115050182 TCCAATTGCTTTCCTATGGAAGG - Intergenic
1014292585 6:119576064-119576086 TCCTCTAACTTTCCCCTGCATGG - Intergenic
1014810962 6:125885138-125885160 TCCTGTTGCTTTCTCCTGCAGGG + Exonic
1014885644 6:126777658-126777680 TTCACTTGCTTTCTCCTGCAGGG + Intergenic
1015166603 6:130206358-130206380 TTTCCTTGCTTTTCCCTGCAAGG - Intronic
1016761516 6:147742741-147742763 TCTCCTTGATCACCTCTGCAGGG + Intergenic
1017368833 6:153679929-153679951 TCCAGTTTCATTCCTCTGCATGG - Intergenic
1018421784 6:163646569-163646591 TCCCCTTGCTTTATTATACAGGG - Intergenic
1018424692 6:163669769-163669791 TCTCCTTCCCTTCCTCTGCAAGG - Intergenic
1019508285 7:1404583-1404605 TGCCCTTGCTCTCATCTGCGGGG - Intergenic
1019836111 7:3385952-3385974 TGCTCTCCCTTTCCTCTGCATGG + Intronic
1021540612 7:21753217-21753239 TCCCCTTCCTTCCCCCTGCCTGG - Intronic
1021554717 7:21907782-21907804 TTCCCCTGCTTTACTCTGCTGGG + Intronic
1021649136 7:22815944-22815966 TCCCCTTAGTTTCCACTGGATGG - Intronic
1021716742 7:23468904-23468926 TCCCCTGGCTTTCTTCAGGAGGG + Intronic
1022092977 7:27119715-27119737 ACCCCTTCTGTTCCTCTGCAGGG - Intronic
1024085703 7:45889861-45889883 TCCCTTTCATTTCCTCTGAAGGG - Intronic
1026818151 7:73528502-73528524 TCCCCTCTCTTTCCTCTCCATGG + Intergenic
1027366223 7:77461314-77461336 TACCCGTGCTTTACTCTGCATGG + Intergenic
1027577928 7:79954186-79954208 TCCCCCTGCTGTACTCTGGAAGG - Intergenic
1028448574 7:90953952-90953974 TCTTCCTTCTTTCCTCTGCAAGG - Intronic
1029456893 7:100676081-100676103 TCCCCTTGCTTACCCCTTCCGGG + Intronic
1030195955 7:106853794-106853816 TCCACGTGCTGTCCTCTGAATGG + Intergenic
1031194915 7:118601105-118601127 TCCCTATGCTTTGCTCTGTAGGG + Intergenic
1031987156 7:128170623-128170645 TTCCCTGGCTTTCCTCTCCAAGG - Intergenic
1032901245 7:136311140-136311162 CCCTCTTGCCTTCCTCTCCAGGG - Intergenic
1034066763 7:148144414-148144436 TCACATTGCTTTCCCTTGCAGGG - Intronic
1034202750 7:149292758-149292780 TCCCCTTGCTTCCTTCAACAGGG - Intronic
1034808086 7:154106080-154106102 ACCCCTTTCTCTCCTCTCCATGG - Intronic
1035026132 7:155827509-155827531 ACTCCGTGCTTTCCTCTCCAGGG - Intergenic
1035545667 8:480477-480499 GCCCCTTGCTTTCCTCACTAAGG - Intergenic
1035779585 8:2217134-2217156 TCCCCTTGGTGCCCTCTGTAGGG + Intergenic
1035779611 8:2217220-2217242 TCCCCTTGGTACCCTCTGCAGGG + Intergenic
1035779638 8:2217303-2217325 TCCCCTTGGTGCCCTCGGCAGGG + Intergenic
1036796954 8:11763321-11763343 ACCCATTGCTTTGCTCAGCAGGG - Exonic
1037042264 8:14250737-14250759 AGCCCTTGCTCTCCTCTGTAGGG + Intronic
1037521931 8:19688402-19688424 ACCCCTTGCCTTCCCCTTCAGGG - Intronic
1038373373 8:27013870-27013892 ACACCTTGTTTACCTCTGCATGG + Intergenic
1038475215 8:27861431-27861453 TCAGCTTTCTTTCCTCAGCAAGG - Intergenic
1038749828 8:30284910-30284932 TCCACTTTCTCTCCTCTGCTGGG + Intergenic
1038780564 8:30565830-30565852 TCCCATGCCTTTCCTCTGCAGGG + Intronic
1039023155 8:33229396-33229418 GCCACTTGCATTCCACTGCAGGG - Intergenic
1039988613 8:42468687-42468709 TGCCGTTTCTTTCATCTGCACGG - Intronic
1040481812 8:47833580-47833602 TCCCCGTGCCTTCCTCTGCTCGG + Intronic
1040516106 8:48136451-48136473 TCCCCTGGCTTTTCCCTGCCAGG + Intergenic
1040550064 8:48430693-48430715 TCCCGTTCATTTCCTCTCCACGG + Intergenic
1040620806 8:49090584-49090606 TCCCCCAGCTTTCCTTTTCAGGG + Intergenic
1040831438 8:51681485-51681507 TCCTCTGGCTTTCCTGGGCAAGG + Intronic
1041190993 8:55354150-55354172 TCCCTCTGCTTTCTCCTGCATGG - Intronic
1045757965 8:105568342-105568364 TCTCCTTTCGTACCTCTGCAGGG + Intronic
1045893750 8:107189004-107189026 TCCAATTGCTTTAATCTGCAAGG + Intergenic
1048842698 8:138579291-138579313 GCCCCTTCCATTCCTCTCCAAGG - Intergenic
1049908278 9:240088-240110 CTCCCTTGTTTTCCTTTGCAAGG + Intronic
1050457638 9:5848940-5848962 TCCACTTGGTTTCCTCAGCTAGG - Intergenic
1051354831 9:16232029-16232051 ACCCCAGGCTTTCCTCTGGAGGG + Intronic
1053662112 9:40291300-40291322 TCTCCTTGCCTCCATCTGCAGGG + Intronic
1053912561 9:42921468-42921490 TCTCCTTGCCTCCATCTGCAGGG + Intergenic
1054374239 9:64437540-64437562 TCTCCTTGCCTCCATCTGCAGGG + Intergenic
1054522498 9:66084984-66085006 TCTCCTTGCCTCCATCTGCAGGG - Intergenic
1054850935 9:69846001-69846023 TCACCTTGCTTTCTTCAGCATGG + Intronic
1056451568 9:86721953-86721975 TCCTCTTGCTTTCCCCTTAAGGG - Intergenic
1056795250 9:89654791-89654813 TCCCCTTGCCTTGCCCTGCATGG + Intergenic
1058982031 9:110178921-110178943 TCCTCTTGCCTTCCATTGCATGG - Intergenic
1058984690 9:110199755-110199777 CCACCTTTCTTTTCTCTGCATGG - Exonic
1059169862 9:112114819-112114841 CCTCCTTTCTTTCCTCTGAAGGG + Intronic
1059424262 9:114210961-114210983 TCCCCTGTCTCTCCCCTGCAGGG + Exonic
1059583413 9:115577538-115577560 TCCCCTTTCTTTCCTGGGTAGGG - Intergenic
1059776247 9:117478189-117478211 CACCCTTGCTTTCCTGTGAAAGG + Intergenic
1059890523 9:118796976-118796998 TCCCCAAGCTTTCCGCTCCAAGG + Intergenic
1062217822 9:135398814-135398836 TCCCCACGCATTCCTCTGCCTGG - Intergenic
1062481791 9:136755742-136755764 TCCCCATGCTGTTCCCTGCAGGG - Intronic
1186960270 X:14728964-14728986 TCACCTTCCTTACCTCTCCAGGG + Intronic
1187186050 X:16986854-16986876 TCCCCTTACTTTTCACTGCTAGG - Intronic
1189077266 X:37929575-37929597 CCCTTTTGTTTTCCTCTGCATGG - Intronic
1193765039 X:85517758-85517780 TCCCCTTGTTTTCTTCTGGGAGG + Intergenic
1193988110 X:88272107-88272129 AACCTTTGGTTTCCTCTGCAGGG - Intergenic
1199004760 X:142682717-142682739 TCCATTTGCTTTCCTTTGTAAGG + Intergenic
1199597978 X:149523069-149523091 TACCATTGCTTTCCTGTGCTGGG - Intronic
1200132429 X:153858121-153858143 CCCCTTTGCTGTCCTCTGCTTGG - Intergenic