ID: 1135415557

View in Genome Browser
Species Human (GRCh38)
Location 16:22265898-22265920
Sequence TGGTGCCTTATATGGGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135415548_1135415557 30 Left 1135415548 16:22265845-22265867 CCTTGCAGAGGAAAGCAAGGGGA 0: 1
1: 0
2: 3
3: 32
4: 319
Right 1135415557 16:22265898-22265920 TGGTGCCTTATATGGGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135415557 Original CRISPR TGGTGCCTTATATGGGGAGC TGG Intronic
No off target data available for this crispr