ID: 1135417354

View in Genome Browser
Species Human (GRCh38)
Location 16:22278743-22278765
Sequence GCGGAGGGCTCTTTTTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135417354_1135417361 0 Left 1135417354 16:22278743-22278765 CCCAAAGAAAAAGAGCCCTCCGC No data
Right 1135417361 16:22278766-22278788 CCTGTTTGCTGTGTATTCTGTGG No data
1135417354_1135417365 17 Left 1135417354 16:22278743-22278765 CCCAAAGAAAAAGAGCCCTCCGC No data
Right 1135417365 16:22278783-22278805 CTGTGGTGCGTGGGTTTGGCTGG No data
1135417354_1135417363 8 Left 1135417354 16:22278743-22278765 CCCAAAGAAAAAGAGCCCTCCGC No data
Right 1135417363 16:22278774-22278796 CTGTGTATTCTGTGGTGCGTGGG No data
1135417354_1135417364 13 Left 1135417354 16:22278743-22278765 CCCAAAGAAAAAGAGCCCTCCGC No data
Right 1135417364 16:22278779-22278801 TATTCTGTGGTGCGTGGGTTTGG No data
1135417354_1135417362 7 Left 1135417354 16:22278743-22278765 CCCAAAGAAAAAGAGCCCTCCGC No data
Right 1135417362 16:22278773-22278795 GCTGTGTATTCTGTGGTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135417354 Original CRISPR GCGGAGGGCTCTTTTTCTTT GGG (reversed) Intronic
No off target data available for this crispr