ID: 1135417534

View in Genome Browser
Species Human (GRCh38)
Location 16:22280142-22280164
Sequence TACCATGGCAACAGGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135417534_1135417541 6 Left 1135417534 16:22280142-22280164 CCTGCCACCCTGTTGCCATGGTA 0: 1
1: 0
2: 0
3: 8
4: 154
Right 1135417541 16:22280171-22280193 ACCTTTCCCTCTGTATCTCCTGG 0: 1
1: 0
2: 0
3: 28
4: 273
1135417534_1135417546 23 Left 1135417534 16:22280142-22280164 CCTGCCACCCTGTTGCCATGGTA 0: 1
1: 0
2: 0
3: 8
4: 154
Right 1135417546 16:22280188-22280210 TCCTGGCAAGGTGCCAAGACTGG 0: 1
1: 0
2: 0
3: 8
4: 149
1135417534_1135417543 11 Left 1135417534 16:22280142-22280164 CCTGCCACCCTGTTGCCATGGTA 0: 1
1: 0
2: 0
3: 8
4: 154
Right 1135417543 16:22280176-22280198 TCCCTCTGTATCTCCTGGCAAGG 0: 1
1: 1
2: 0
3: 28
4: 217
1135417534_1135417548 30 Left 1135417534 16:22280142-22280164 CCTGCCACCCTGTTGCCATGGTA 0: 1
1: 0
2: 0
3: 8
4: 154
Right 1135417548 16:22280195-22280217 AAGGTGCCAAGACTGGCTAGAGG 0: 1
1: 0
2: 2
3: 17
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135417534 Original CRISPR TACCATGGCAACAGGGTGGC AGG (reversed) Intronic
900985976 1:6072957-6072979 TGCCATGGCAACAAAGAGGCAGG + Intronic
901671732 1:10860146-10860168 GACAATGGCAACAGGGGGCCTGG - Intergenic
902233848 1:15045169-15045191 TACCTTCCCCACAGGGTGGCTGG + Intronic
902722261 1:18311810-18311832 TACCATGAGAACAGTGTGGGGGG + Intronic
902851807 1:19164374-19164396 TCCCATGGCAACAGAGATGCTGG - Exonic
905870956 1:41404445-41404467 TACCATGACAACAGGATGCGAGG + Intergenic
906529414 1:46514943-46514965 GACCATGGGAAGGGGGTGGCTGG + Intergenic
906742996 1:48200701-48200723 TACCATGGCAATCTGGAGGCAGG - Intergenic
907193518 1:52668060-52668082 GGCCATGGCAGCAGGGTGGCTGG + Intronic
907455406 1:54572358-54572380 CACCATGGCAACAGGTGGCCAGG - Intronic
910442023 1:87262659-87262681 TACCATGGCAGCATCCTGGCAGG - Intergenic
913616384 1:120564339-120564361 TACCCAGGCAACAGGATGGATGG + Intergenic
914573893 1:148946565-148946587 TACCCAGGCAACAGGATGGATGG - Intronic
918239159 1:182606613-182606635 AACCATGGCAACAAAGAGGCAGG - Intergenic
918310996 1:183285134-183285156 TGACATGCCAACAGGTTGGCAGG - Intronic
923129872 1:231065885-231065907 TACCCTGGTAACAGGATGGTGGG - Intergenic
1063260628 10:4385422-4385444 TGCCATGGGAACAGGGCTGCTGG - Intergenic
1064630969 10:17310374-17310396 TCACATGGCAAAAGGGTGGATGG - Intergenic
1072895374 10:99362093-99362115 TACCTGGGCATCAGGTTGGCAGG - Intronic
1073729893 10:106275177-106275199 TACTATGGCAACAGTGTGATGGG - Intergenic
1077394938 11:2316104-2316126 TGCCAGGGCAGCAGGGCGGCGGG - Intronic
1077656631 11:4025569-4025591 TAACATGAGGACAGGGTGGCTGG + Intronic
1081765392 11:45606690-45606712 TACCATGGCAACCCTGCGGCGGG - Intergenic
1088210235 11:107446497-107446519 TACCATGGCATCATGTTGGATGG + Intronic
1089625118 11:119746171-119746193 TACCAAGGAGACAGAGTGGCCGG - Intergenic
1089890443 11:121875296-121875318 GACCATGGCAACATGGTACCAGG - Intergenic
1089896949 11:121940198-121940220 TAAAATTGCAACAGGGAGGCTGG - Intergenic
1091275511 11:134346766-134346788 GATCATAGCAACAGGGTGGAGGG + Intronic
1099032812 12:77549385-77549407 TAACATGGCAACAGGGTAACAGG - Intergenic
1100575022 12:95882977-95882999 TAGCATGGCAACTGGGTGCATGG - Intronic
1102562079 12:113769489-113769511 TACCATGGCAACAGATGTGCCGG - Intergenic
1103336973 12:120196985-120197007 TACCAAGGCAGGAGGGTGGTGGG - Intronic
1103367073 12:120391034-120391056 TGCCATGGGAAGAGGGGGGCAGG - Intergenic
1104634368 12:130428319-130428341 CTCCATGGCAACAGTGCGGCTGG + Exonic
1105473374 13:20711477-20711499 TGCCATGGTAACAGTGTGGGAGG - Intronic
1109579473 13:64308057-64308079 TACCATGACAACAGCATGGGGGG + Intergenic
1112333456 13:98494993-98495015 AACCCAGGCAACAGGATGGCGGG + Intronic
1113461675 13:110486289-110486311 TACCATCACAACAGCGTGTCTGG - Intronic
1113559609 13:111267685-111267707 CACCTTGGCAACAGGGAGGGTGG + Intronic
1115509235 14:34123697-34123719 TACCAGGGAAAGAGGGAGGCAGG - Intronic
1116346562 14:43802424-43802446 GACCATGGCAAACGGGAGGCAGG + Intergenic
1118033125 14:61837780-61837802 AAACATGGCCACAAGGTGGCAGG - Intergenic
1118257419 14:64217120-64217142 TACCATGGCAATGGATTGGCAGG - Intronic
1119556492 14:75557410-75557432 TCCCATGGCAGAAGGGTGGAAGG + Intergenic
1119556617 14:75558318-75558340 TCCCATGGCAGAAGGGTGGAAGG + Intergenic
1119774481 14:77239879-77239901 TCCCATCTCAACAGGGAGGCAGG - Intronic
1121518918 14:94572264-94572286 TACTATGGCAACAGCATGGCAGG + Intronic
1122715411 14:103693941-103693963 TGTCATGGCAAAAAGGTGGCAGG - Intergenic
1122837762 14:104438361-104438383 TCCCATGGCAAAGGGGTTGCAGG + Intergenic
1123106838 14:105845746-105845768 GACCCTGGCAGCAGGGTGACAGG + Intergenic
1127618285 15:60708701-60708723 TACCCTGGGAACAGGGTTGGGGG - Intronic
1127704660 15:61535072-61535094 TCCCATAGCCAAAGGGTGGCTGG + Intergenic
1128805131 15:70525162-70525184 TTCCATGGCACCTTGGTGGCAGG - Intergenic
1131068356 15:89448560-89448582 TCACATGGCAAGAGGGTGGTGGG + Intergenic
1131172021 15:90185252-90185274 TGCCATGGCAACAGGCTCCCCGG - Intronic
1131280011 15:91013559-91013581 TCCCATGGCAGAAGGGTGGAAGG - Intronic
1135417534 16:22280142-22280164 TACCATGGCAACAGGGTGGCAGG - Intronic
1137377495 16:47965629-47965651 TACCAAAGCAACAGGGAGACTGG - Intergenic
1139751266 16:69110153-69110175 TAAGAAGGCAACAAGGTGGCCGG + Intronic
1139953516 16:70682893-70682915 GCCCACGGCCACAGGGTGGCGGG + Intronic
1146285050 17:31568662-31568684 TAAGAAGGCAAGAGGGTGGCTGG - Intergenic
1146409768 17:32572516-32572538 TAGCAAGACAAGAGGGTGGCTGG - Intronic
1150211895 17:63446329-63446351 CGCCATGGCAACCGGGCGGCGGG + Intronic
1156367310 18:36440923-36440945 TAGCAGGGCAGGAGGGTGGCGGG - Intronic
1158477157 18:57790445-57790467 TACCATGGGATAAGGGAGGCAGG - Intronic
1161550645 19:4910298-4910320 TACCATGGCCACCGCGGGGCGGG + Intronic
1162742767 19:12782886-12782908 TCCCATGGCAACTGGGGGGGGGG - Intronic
1162835545 19:13314985-13315007 TACCATGGAAACATGATAGCAGG + Intronic
1163457807 19:17418819-17418841 TGTCATGGCAACAGGGTAACAGG - Intronic
1164830791 19:31318963-31318985 AGCCATGGCACCAGGGTGGTAGG - Intronic
1165331655 19:35143626-35143648 CGCTATGGCAACCGGGTGGCTGG + Intronic
1166144388 19:40824143-40824165 TTCCCTGGCAAGTGGGTGGCTGG + Intronic
1167112150 19:47468830-47468852 TACCATGGCAACATGAGGGTGGG - Intronic
1168562580 19:57396282-57396304 CTCCATGGCAACTGGCTGGCAGG + Intronic
926222811 2:10947493-10947515 TCCCATGGGAAGCGGGTGGCAGG + Intergenic
927576966 2:24208221-24208243 TACCAAGGTATCAGGGTGCCCGG - Exonic
929657931 2:43752635-43752657 TGCCATGACAACACAGTGGCTGG - Intronic
930434864 2:51327999-51328021 AACCATGGCCACAGGGTCACTGG - Intergenic
931575809 2:63717283-63717305 CAACATGGCAAGATGGTGGCAGG + Intronic
942598757 2:177618729-177618751 TACCACGGCAACAGGGCAACCGG + Exonic
942946776 2:181681600-181681622 AACCATGGCCACTGGGTTGCTGG + Intergenic
945158278 2:206862036-206862058 TGCCACAGCAACATGGTGGCAGG + Intergenic
947709807 2:232306416-232306438 TACCGTGGCAACTGGGGGCCGGG - Intronic
1171327977 20:24312583-24312605 TTCCATGGAAACTGGTTGGCTGG - Intergenic
1172992599 20:39047613-39047635 CACCACGGCACCAGGGAGGCTGG - Intergenic
1173047378 20:39525642-39525664 TTCCATGGAAACAGGATGTCAGG + Intergenic
1173332165 20:42084640-42084662 CACCAGGGCAATAGGGTGGTGGG - Intronic
1176134864 20:63518068-63518090 GACAGTGGCTACAGGGTGGCAGG + Intergenic
1178552241 21:33550821-33550843 GACAACGGCAACAGGGTTGCTGG + Exonic
1179166396 21:38938525-38938547 TACCATGGCAACAGTGTCCCTGG - Intergenic
1179391975 21:41002352-41002374 CTCCATGGCAACAGGGTTCCAGG - Intergenic
1180183239 21:46127225-46127247 TGCCATGGAGACAGGGTGGGAGG + Intronic
1181474429 22:23159614-23159636 TTCCAGGGCCACAGGGTGGCAGG + Intronic
1182623921 22:31632301-31632323 ACCCATGGGAACAGGGAGGCAGG + Intronic
1184499365 22:44862471-44862493 CACCATGGGAACAGGGGAGCAGG + Exonic
950365095 3:12477581-12477603 TCCTATGGGAGCAGGGTGGCTGG - Intergenic
961382146 3:126501888-126501910 TCCCAGGGCAGCAGGGAGGCCGG + Exonic
962236494 3:133711687-133711709 TGGCCTGGCAACAGGGTGGATGG - Intergenic
962682740 3:137816482-137816504 TACCAGGTCATAAGGGTGGCAGG + Intergenic
965842206 3:172919320-172919342 TACCATAGCAGCAGGGCTGCTGG + Intronic
966720795 3:183061138-183061160 GACCATTGCAACATGGTGGTAGG + Intronic
967884716 3:194325659-194325681 TTCTGTGGCCACAGGGTGGCAGG + Intergenic
968605710 4:1534357-1534379 TCCCGGGGCAACAGGGTGGAAGG - Intergenic
969227323 4:5807521-5807543 AATAATGGAAACAGGGTGGCTGG + Intronic
969370288 4:6727534-6727556 CACCAAGGCCACAGGGTGCCGGG + Intergenic
973219606 4:47710683-47710705 TTACAGGGCAACAAGGTGGCCGG - Intronic
973850582 4:54957709-54957731 TACCATGGCACCAGTGTGTAAGG + Intergenic
975358644 4:73440143-73440165 TACCCAGGCAACAGGTTGGTAGG - Intronic
975859914 4:78665793-78665815 TTCCATGGCAAAAGGATGGATGG - Intergenic
977759020 4:100708374-100708396 AACCAAGACATCAGGGTGGCAGG + Intronic
980229549 4:130031540-130031562 TGCCATGGCACCTGGGTGTCAGG + Intergenic
980397140 4:132228274-132228296 TGCCTTGGCACCTGGGTGGCTGG + Intergenic
984429066 4:179625224-179625246 TACTAAGGCAACAGGGAAGCAGG - Intergenic
986432982 5:7699842-7699864 TACCATGTCAACAGTTTGGGAGG - Intronic
987066287 5:14293073-14293095 CTCCATGGCATGAGGGTGGCTGG - Exonic
987657990 5:20832989-20833011 TACCACTGCCCCAGGGTGGCAGG + Intergenic
987799280 5:22672545-22672567 TCCCATGGCAGAAGGGTGGATGG - Intronic
988705659 5:33723842-33723864 TACTATGGCAATAGAGTGGAAGG - Intronic
989421056 5:41240456-41240478 GGCCATGGCAGTAGGGTGGCGGG + Intronic
990243008 5:53834491-53834513 TACCATGGGAAATGGGTGGGTGG - Intergenic
995508953 5:112888938-112888960 TACCATGAGAACAGTATGGCAGG - Intronic
997445255 5:133935583-133935605 CATCCTGGCAGCAGGGTGGCAGG + Intergenic
997714416 5:136031184-136031206 AACCATGGCAAAATGGTTGCAGG + Intronic
997978958 5:138457386-138457408 TACAGTGGCAGCAGGGTGGTTGG - Intergenic
1001334068 5:170783392-170783414 TTCCATTGCACCAGGGTGGAGGG + Intronic
1001646670 5:173287277-173287299 TACCAGGGCAGTAGGGAGGCGGG + Intergenic
1004145600 6:13063176-13063198 TACCATTGCAACAGTGAGGACGG + Intronic
1012620613 6:101339698-101339720 CAGCATGGCCACAGGGAGGCAGG - Intergenic
1017024139 6:150166729-150166751 TGCTAAGGGAACAGGGTGGCTGG + Intronic
1019719345 7:2559048-2559070 TGCCATGGCAGCGGGGTCGCGGG + Exonic
1023227074 7:37981974-37981996 TTCCAAGGTAACAGGGTGGTAGG + Intronic
1023274876 7:38507811-38507833 GATCATGGCAACAGGAGGGCAGG + Intronic
1024315976 7:48016880-48016902 TACCATGGCAGAAGGGTGAAAGG + Intronic
1024526357 7:50353310-50353332 CATCATGGCAAGAGTGTGGCTGG - Intronic
1028921156 7:96311883-96311905 AGCTATGGCAACAGGGTAGCAGG - Intronic
1030874459 7:114795762-114795784 TACCCTGGCAACTGTGTGGAAGG - Intergenic
1033221124 7:139526641-139526663 TTCCATTGCCACAGGCTGGCGGG + Intronic
1037992151 8:23328646-23328668 TGGCCTGGGAACAGGGTGGCAGG - Intronic
1041057789 8:54005576-54005598 TGCCATGGCAACTGGGTAGATGG - Intronic
1041251729 8:55940866-55940888 CACCATGGCAAGAAGGGGGCTGG - Intronic
1042101819 8:65282378-65282400 TACCATGGCAACAGGAGAGTAGG - Intergenic
1042501853 8:69517141-69517163 TCCCATGGCAGAAGGGTGGAAGG + Intronic
1046018245 8:108632025-108632047 TACCATTTCAACTGGGAGGCAGG + Intronic
1047809248 8:128390457-128390479 TTCCATGGCAACAGAGTGTCTGG + Intergenic
1049831526 8:144704349-144704371 CACCATGGCATCATGGTTGCAGG - Intergenic
1052043479 9:23767974-23767996 GACCATGGCAATGGAGTGGCTGG - Intronic
1052995611 9:34550329-34550351 TGTGATGGCATCAGGGTGGCTGG + Intergenic
1053178283 9:35945336-35945358 GGCCATGGCTACAGGGGGGCAGG - Intergenic
1053489503 9:38488288-38488310 TTCCAGGCCCACAGGGTGGCTGG - Intergenic
1055725332 9:79221705-79221727 TACCATGAGAACAGTGTGGGGGG - Intergenic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1057669847 9:97077608-97077630 TTCCAGGCCCACAGGGTGGCTGG - Intergenic
1057824305 9:98360359-98360381 TACCATAGCAACAGAGGGACAGG + Intronic
1061542488 9:131285114-131285136 TAACATGGGAAGAGGGTGGTTGG + Intergenic
1186768620 X:12795565-12795587 TCCCATGGCAGAAGGGTGGAAGG + Intronic
1187415071 X:19086392-19086414 AACCATGACATCAGGGAGGCTGG + Intronic
1188837511 X:34977484-34977506 GACCATGACAACAGGAAGGCTGG + Intergenic
1190317000 X:49157434-49157456 GACCCTGGAAACAGGGTGGCGGG + Intergenic
1192181558 X:68919106-68919128 CACCCTGGCTACAGGGTGGTGGG + Intergenic
1194946417 X:100073967-100073989 TACTATGACAACAGTGGGGCAGG - Intergenic
1196397488 X:115280739-115280761 TACCCAAGCAACAGGGTGGGGGG - Intergenic
1196779018 X:119365769-119365791 TAGCATGGCAACAGTGTGGTAGG - Intergenic
1199058006 X:143319925-143319947 TACCATGGCAGATGGGAGGCAGG - Intergenic