ID: 1135421634

View in Genome Browser
Species Human (GRCh38)
Location 16:22309065-22309087
Sequence CTGTGTGAACGCAGGGAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135421634_1135421642 28 Left 1135421634 16:22309065-22309087 CCGGTTTCCCTGCGTTCACACAG 0: 1
1: 0
2: 2
3: 13
4: 192
Right 1135421642 16:22309116-22309138 ACCCCCTTTGCCCCGTCACTGGG 0: 1
1: 0
2: 1
3: 4
4: 89
1135421634_1135421641 27 Left 1135421634 16:22309065-22309087 CCGGTTTCCCTGCGTTCACACAG 0: 1
1: 0
2: 2
3: 13
4: 192
Right 1135421641 16:22309115-22309137 GACCCCCTTTGCCCCGTCACTGG 0: 1
1: 0
2: 0
3: 12
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135421634 Original CRISPR CTGTGTGAACGCAGGGAAAC CGG (reversed) Intronic
902395245 1:16128910-16128932 CTGTGTGACCTCAGGCAAGCCGG + Intronic
903625802 1:24729568-24729590 CTGAGTGAATCCAGGGACACTGG + Intergenic
904565347 1:31425275-31425297 CTGAGTGCAGGCAGGGAAACTGG - Intronic
908782300 1:67701444-67701466 CTGAGTGAAGGAAGGGAAAGGGG + Exonic
911834774 1:102603406-102603428 CTGTGTAAAAGCAAGGCAACAGG - Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
915979290 1:160410090-160410112 CTGCCTGAACACAGGGAAATGGG - Intronic
916661280 1:166924288-166924310 CTGTGTGATCCCTGGGATACTGG - Intronic
917118927 1:171628876-171628898 ATGTGTTAAAGCAGTGAAACAGG + Intergenic
917177047 1:172246875-172246897 ATGTTTGCAAGCAGGGAAACTGG - Intronic
917393273 1:174562801-174562823 CAGTGAGAACACAGGGACACAGG + Intronic
919076092 1:192814636-192814658 GTGTGTGAACTCTGGGAAACTGG - Intergenic
920246015 1:204588270-204588292 CTGTGTGATCTCAAGCAAACTGG - Intergenic
921705681 1:218320254-218320276 CAGTGAGAACGCATGGACACAGG - Intronic
922786690 1:228286430-228286452 CTCTGTGAGCCCAGGGATACTGG - Intronic
922817686 1:228462283-228462305 TGGTGAGAACGCAGGGAAAGGGG + Intergenic
923726833 1:236513250-236513272 CTGTGTAAACACAGGGTAAATGG - Intergenic
924401216 1:243684351-243684373 CAGTGAGAACACAGGGACACAGG - Intronic
1063115942 10:3071925-3071947 CTCTGTGAACTCAGGGAAGGTGG - Intronic
1068398435 10:56495187-56495209 CAGTGGGAACACATGGAAACAGG + Intergenic
1071300196 10:84250662-84250684 CAGTGTGAAGGCAGGCAAAGGGG + Intronic
1072524929 10:96263306-96263328 ATGTGTGAAGGAAGGGAATCTGG + Intronic
1074868017 10:117556082-117556104 CTGGGAGAAAGCAGGGAAGCGGG - Intergenic
1076552727 10:131294109-131294131 CAGTGTGAAAACAGGGATACTGG - Intronic
1076806338 10:132861024-132861046 ATGTGTGCAGGCAGGGAGACAGG + Intronic
1076946904 10:133657829-133657851 CTGTTTGAATGCAGAGAAAGTGG + Intergenic
1077094781 11:794670-794692 CTGTTTGACAGAAGGGAAACGGG - Intronic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1078645223 11:13135906-13135928 CTGTGTTTATGCAGGGAAATGGG - Intergenic
1082298582 11:50475660-50475682 CAGTGTGAACACATGGACACAGG + Intergenic
1085025012 11:73231243-73231265 CTTGGTGAAAGAAGGGAAACTGG + Intronic
1086810917 11:91309036-91309058 CAGTGAGAACGCATGGACACAGG - Intergenic
1088428921 11:109735957-109735979 CAGTGAGAACGCATGGACACAGG + Intergenic
1089376512 11:117998935-117998957 CTGACAGAACGCTGGGAAACAGG + Exonic
1091390058 12:120711-120733 CTTTGAGAAAGTAGGGAAACAGG - Intronic
1092052981 12:5486098-5486120 CTGTGTGGCAGCAGGGAGACAGG + Intronic
1094330168 12:29282771-29282793 CTCTTTGACAGCAGGGAAACTGG - Intronic
1096933251 12:55239774-55239796 TTGTGTCAACACATGGAAACAGG + Intergenic
1097730478 12:63123188-63123210 CTGTGGGAACCTAGGGACACAGG + Intergenic
1099186236 12:79518289-79518311 ATGAGTGAATGCAGTGAAACAGG - Intergenic
1101019365 12:100537553-100537575 CTGTTTGAACACAGAGGAACTGG + Intronic
1103852328 12:123941230-123941252 CTGTGGGAATGCAGAGGAACAGG - Intronic
1104667627 12:130658648-130658670 CTCTGTGGACTCAGGGCAACCGG - Intronic
1105439750 13:20405343-20405365 GTGTGTGAACGCAGGCCAACCGG - Intronic
1106707970 13:32301692-32301714 CTGTAAGAAAGCAGAGAAACTGG - Intergenic
1107176726 13:37407668-37407690 CGATGAGAACGCAGGGACACAGG + Intergenic
1109567553 13:64137193-64137215 TTGTGTGAATGCAGTGAAAAGGG + Intergenic
1110470009 13:75848891-75848913 TGGTGTGAATGCAGGGAAAAGGG - Intronic
1115528990 14:34308746-34308768 CTGTGTGAAGGAAAGGAAAAAGG - Intronic
1116680874 14:47968351-47968373 CTATGAGAACGCATGGACACAGG - Intergenic
1116915217 14:50518437-50518459 CAGTGAGAACACAGGGACACAGG - Intronic
1118907446 14:70032968-70032990 GTGTGTGCACACAGGGAAAAAGG - Intergenic
1119477376 14:74938962-74938984 CTGTGTGAAAGAAGAGAAAAGGG - Intergenic
1119513275 14:75228350-75228372 CTGTGGGAACAAAGGGAAAAAGG - Intergenic
1120287659 14:82524838-82524860 CTTTGTGAACTCAGGGGAAAGGG + Intergenic
1202920978 14_KI270723v1_random:30385-30407 CTGTTTGAATGCAGAGAAAGTGG + Intergenic
1202923939 14_KI270724v1_random:7196-7218 CTGTTTGAATGCAGAGAAAGTGG - Intergenic
1123576085 15:21670677-21670699 CAGTGAGAACACAGGGACACAGG - Intergenic
1123612706 15:22113151-22113173 CAGTGAGAACACAGGGACACAGG - Intergenic
1125065430 15:35479199-35479221 CTGTGTGACCAGAGGAAAACTGG + Intronic
1125474328 15:40035814-40035836 CTGTGAGAACTCATCGAAACTGG + Exonic
1128498068 15:68209531-68209553 CTGTGTGGCCCCAGGGAGACTGG - Intronic
1132141328 15:99399133-99399155 CTGTGTGAACACCGAGAAAATGG + Intergenic
1202984953 15_KI270727v1_random:404922-404944 CAGTGAGAACACAGGGACACAGG - Intergenic
1132546873 16:537270-537292 CTGAGTGAGCGCAGGGGAGCAGG + Intronic
1133743244 16:8667499-8667521 CTGTGAGAACACATGGACACAGG - Intergenic
1135175792 16:20227629-20227651 CTGGCTGAATGCAGGGAACCTGG + Intergenic
1135421634 16:22309065-22309087 CTGTGTGAACGCAGGGAAACCGG - Intronic
1135630948 16:24035308-24035330 CTGTCTCAAAGGAGGGAAACAGG + Intronic
1136477446 16:30522292-30522314 CTGGGTGAATGCAGGAAGACAGG - Exonic
1141245583 16:82303613-82303635 CAGTGAGAACACATGGAAACAGG - Intergenic
1142918005 17:3159317-3159339 CAGTGAGAACACAGGGACACAGG + Intergenic
1143672348 17:8405460-8405482 CTATGTGCACTCAGGGCAACAGG - Intergenic
1147453629 17:40521114-40521136 CTGTGTGAATGGAGGGATGCAGG - Intergenic
1153306459 18:3636105-3636127 ATGTGTCAAGTCAGGGAAACAGG - Intronic
1153348116 18:4050183-4050205 CTGTGTGCACTTAGAGAAACAGG - Intronic
1154235767 18:12604109-12604131 CTCTCAGAACTCAGGGAAACAGG - Intronic
1154294753 18:13138313-13138335 CTGTGGGGCCGAAGGGAAACTGG - Intergenic
1154404120 18:14072685-14072707 ATGTATGAAAGCAGGAAAACCGG + Intronic
1154511293 18:15105379-15105401 CAATGTGAACGCATGGACACAGG + Intergenic
1156650216 18:39216865-39216887 CTGTGTGATTTCAGGGACACTGG + Intergenic
1157161877 18:45321055-45321077 CTGTGTAAACACAAGAAAACAGG - Intronic
1157685876 18:49641889-49641911 GTGTGTGAAGCCAGGGAACCTGG + Intergenic
1157943563 18:51955077-51955099 CTGTGTAAAGGGAGGGAAAAGGG + Intergenic
1159482034 18:69001873-69001895 TTGTATCAAGGCAGGGAAACTGG - Intronic
1161024699 19:2030937-2030959 CTCTCTGAACCCAGGGAAAGTGG - Intronic
1162475436 19:10896674-10896696 GTGCAGGAACGCAGGGAAACAGG - Intronic
1164744478 19:30601073-30601095 CTGTGGGAACACAGGGAATATGG - Intronic
1165607881 19:37122410-37122432 CAGTGAGAACACAGGGACACAGG + Intronic
1165968869 19:39608361-39608383 CTGGGTGAACACATAGAAACTGG + Intergenic
1165974343 19:39661528-39661550 CTGAGTGAACACCTGGAAACTGG + Intergenic
1166910680 19:46154031-46154053 CTGTGAGAACACATGGACACAGG - Intronic
925276465 2:2651668-2651690 CTGTGGGAAAGCAGGGAGGCAGG + Intergenic
925597581 2:5571151-5571173 CTGAGTGAACGGAGGGAAAGAGG - Intergenic
925665705 2:6252988-6253010 CTTTGGGGACTCAGGGAAACGGG - Intergenic
927722531 2:25394739-25394761 CGGTGTGAATGCAGTGAAAAAGG + Intronic
929002501 2:37361847-37361869 CTGTGTGAACGCTGGTAATTAGG + Intronic
930358787 2:50352001-50352023 TTGTGTGAACTCTTGGAAACGGG + Intronic
930994010 2:57694543-57694565 CAGTGAGAACGCAGGCACACAGG + Intergenic
933557816 2:83852053-83852075 CAGTGAGAACACAGGGACACAGG + Intergenic
936785081 2:116085134-116085156 CTGTATGAAAGCAGATAAACGGG + Intergenic
938275094 2:130013128-130013150 CTCTCTGACAGCAGGGAAACTGG + Intergenic
938506505 2:131889836-131889858 CAATGTGAACGCATGGACACAGG + Intergenic
938698466 2:133855527-133855549 CTGTCTGAACTCTGGGAAGCTGG - Intergenic
938951562 2:136259337-136259359 CTGGGTGAACTCAGGATAACTGG - Intergenic
940166596 2:150780473-150780495 CTGTGGCAAAGCAGGGAAAAAGG - Intergenic
941616966 2:167731658-167731680 CTGTGTGAATGAAGGAAACCAGG + Intergenic
942662581 2:178281994-178282016 CTGTGTGTACTCCGGGAAGCAGG - Intronic
948947637 2:241229156-241229178 CTGTCTGGACCAAGGGAAACTGG + Exonic
1169405651 20:5318818-5318840 GGGTGTGAACCCAGAGAAACTGG + Intergenic
1169457057 20:5761203-5761225 CAGTGAGAACACAGGGACACAGG + Intronic
1173486144 20:43442602-43442624 CTCTGTGAACTCTGGGAGACGGG - Intergenic
1174197373 20:48783024-48783046 CTGTGTAAACCCAGGCAACCTGG - Intronic
1175268566 20:57717690-57717712 CTGTGGGAACCCAGAGGAACAGG + Intergenic
1177985736 21:27972544-27972566 CAATGTGAACGCAAGGACACAGG - Intergenic
1179353904 21:40640640-40640662 CTCTGGGAGCGCAGGTAAACAGG + Intronic
1180005130 21:45017248-45017270 GTGTGTGCACGCAGGGAACGTGG - Intergenic
950166862 3:10807554-10807576 CTGTGAGGACACAGGGAAAAAGG - Intergenic
951847110 3:27096594-27096616 CTGTGTAAACACAGCAAAACCGG - Intergenic
955559656 3:60174978-60175000 CTGTGTGAACGAAAGGATAGGGG + Intronic
956760308 3:72437151-72437173 ATGTTTAAACTCAGGGAAACGGG - Intronic
957080555 3:75632587-75632609 CTGTTTGAATGCAGAGAAAGTGG - Intergenic
960939407 3:122923580-122923602 GTGTGTGAAGACAGGGAAAGAGG + Intronic
962038530 3:131680827-131680849 CTGTGGGGACGCAGGGGAAAGGG - Intronic
962897346 3:139728312-139728334 CTGTGAGAAAGCAGGGAAAATGG + Intergenic
963052254 3:141152233-141152255 CTGTGGGAATGCAGGGAGCCTGG - Intergenic
964761456 3:160138265-160138287 CTGTTTGAATGGAGGGTAACTGG + Intergenic
966227495 3:177613728-177613750 CTGTGTGAATGCAGGTAACAGGG - Intergenic
967475016 3:189906574-189906596 CTGTATGAAGGCAGAGAAACTGG - Intergenic
967494982 3:190133079-190133101 CTGTGTGGTTGCAGGGAAAAAGG - Intergenic
968943359 4:3650976-3650998 CTGTCTGCACGCAGGGATGCCGG - Intergenic
969594271 4:8140049-8140071 CAGTGAGAACACATGGAAACGGG + Intronic
971285418 4:25284687-25284709 CAGTGAGAACACAGGGACACAGG - Intergenic
971577930 4:28300906-28300928 CTGTGAGAACACAGGGACACAGG + Intergenic
971740739 4:30517356-30517378 CAGTGAGAACACAGGGACACAGG + Intergenic
974596123 4:64016244-64016266 CCATGTGAAAACAGGGAAACAGG - Intergenic
978650195 4:110994516-110994538 CAGTTTGCACTCAGGGAAACTGG + Intergenic
979099251 4:116594648-116594670 CTGTGTAAATGCATGGAATCTGG + Intergenic
979215662 4:118161143-118161165 CTGTGGATACGCAGGCAAACAGG - Intronic
980676212 4:136085210-136085232 CTCTGGGAACACAGGGACACAGG + Intergenic
982103279 4:151989523-151989545 CTGTGTAACCACAGGGAAGCAGG - Intergenic
984594661 4:181653907-181653929 CTGTGAGAACGCATGGACACAGG - Intergenic
986544966 5:8886446-8886468 CAGTGAGAACGCATGGACACAGG + Intergenic
987027190 5:13939514-13939536 CTGTGGGAAGACAGGGAAACAGG - Intronic
989429227 5:41332891-41332913 CAGTGTGAACACATGGACACAGG + Intronic
990746842 5:58967256-58967278 ATGTGGGAACACAGGGAAAGAGG - Intergenic
990968035 5:61471074-61471096 CTTTGTGAATGAAGGGGAACTGG + Intronic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
993586815 5:89741405-89741427 CAGTGAGAACGCATGGACACAGG - Intergenic
994388163 5:99157619-99157641 CAGTGAGAACACAGGGACACAGG - Intergenic
995385563 5:111585092-111585114 CTGTGAGAATGCAGGGAAATAGG + Intergenic
995735789 5:115297919-115297941 CTGTGAGAAGGGAGGAAAACCGG + Intergenic
996021534 5:118595948-118595970 CTGTGTGAAGACAGGGAACATGG - Intergenic
1000593053 5:163182086-163182108 CAATGAGAACGCAGGGACACAGG + Intergenic
1001818912 5:174694387-174694409 CTGTCAGAACGCAGGGAAGTCGG - Intergenic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1002642525 5:180636981-180637003 CTGTGTGCACCCAGGAAAATGGG - Intronic
1002889763 6:1322394-1322416 CTGGGTGACCTTAGGGAAACGGG + Intergenic
1002915296 6:1524003-1524025 CTGTGTGAATGCAGGGAAAGCGG + Intergenic
1003682495 6:8269710-8269732 CTGGGAAAAGGCAGGGAAACAGG + Intergenic
1004394966 6:15239632-15239654 CTGTGAGTAGGCAGGGAAAGGGG - Intergenic
1006119845 6:31797297-31797319 CTGGGTTAACGCAGAGTAACAGG + Intergenic
1007313142 6:40962646-40962668 CTGCATGAATTCAGGGAAACTGG - Intergenic
1007353753 6:41294813-41294835 CAGTGTGAACACAGGCACACAGG + Intergenic
1011830749 6:91368403-91368425 CAGTGAGAACACAGGGACACAGG - Intergenic
1014012074 6:116487380-116487402 CAGTGTGAACACATGGATACAGG - Intergenic
1014931027 6:127336463-127336485 CTTTGGGAAAGCAGGGAAATAGG - Intronic
1015022734 6:128495901-128495923 CTGTGTGAAGACATGGAGACTGG - Intronic
1016441520 6:144089346-144089368 CTTTATGAAAGCAGGGAAGCAGG + Intergenic
1016446078 6:144133247-144133269 CAGTGTGAATGGAGGGAAAGTGG - Intergenic
1017555859 6:155567459-155567481 CTTTGAGAACTCAGGGAAAAGGG - Intergenic
1017569927 6:155732995-155733017 CTGTGGGGACTCAAGGAAACTGG - Intergenic
1018273175 6:162102232-162102254 CAGTGAGAACACAGGGACACAGG - Intronic
1020124687 7:5526876-5526898 CTGGGTGAACCCAGAAAAACTGG + Intergenic
1021974366 7:25997315-25997337 CTGTGTGAACATGGGGAAATGGG + Intergenic
1022110110 7:27224797-27224819 CTGTGTGCTCACAGGCAAACAGG - Intergenic
1023114399 7:36847561-36847583 CTATGAGAACGCATGGACACAGG + Intergenic
1024548667 7:50542509-50542531 CTGTGTGATCGCAGGAAACCAGG - Intronic
1026277984 7:68896871-68896893 GTGGGTGAATGCATGGAAACAGG + Intergenic
1027358276 7:77381623-77381645 CTGAGGGAACCCAGGGAAGCAGG - Intronic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035820795 8:2589474-2589496 GTGTGAGGACGGAGGGAAACAGG - Intergenic
1037043731 8:14270994-14271016 CAGTGAGAACGCAAGGACACAGG + Intronic
1037773105 8:21814587-21814609 CCGTGTGATCGCAGGGAAAGGGG + Intergenic
1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG + Intronic
1045393884 8:101741164-101741186 GTGTGTGTACACAGGGATACAGG - Intronic
1048553714 8:135456542-135456564 CTGTTTGAAGGCAGGAAAAATGG + Intergenic
1048797675 8:138166380-138166402 ATGTGTGAAAGCAGCAAAACAGG + Intronic
1049519027 8:143078917-143078939 CTATGTGGACGCAGGGGAAATGG + Intergenic
1050396898 9:5207887-5207909 CTGTATAAAGGCAGGGAAAGTGG - Intergenic
1050615330 9:7395808-7395830 CTGGGTAAACTAAGGGAAACTGG + Intergenic
1050804547 9:9657399-9657421 CAGTGAGAACGCATGGACACAGG + Intronic
1057035957 9:91811727-91811749 CTGAGGGAGTGCAGGGAAACAGG - Intronic
1057328395 9:94088613-94088635 CTGTGTGATCTTAGGCAAACAGG - Intronic
1059542310 9:115143113-115143135 CTGTGTGAACACAGGGAAAAAGG + Intronic
1062372024 9:136245061-136245083 GTGTGTGGACGCTAGGAAACAGG + Intronic
1187989878 X:24858811-24858833 GTGTGTGAGAGCAGGGAAAATGG - Intronic
1188002457 X:24995200-24995222 CTGTGTGAACTCAGGGTATGCGG - Intronic
1189105070 X:38227147-38227169 CTCTGAGAACGCATGGACACCGG + Intronic
1190684644 X:52860810-52860832 CAGTGAGAACACATGGAAACAGG + Intergenic
1195401425 X:104465261-104465283 CAGTGAGAACGCATGGACACAGG - Intergenic
1200877090 Y:8168563-8168585 CTGTATGAACAAAGGGAATCAGG + Intergenic
1201610917 Y:15841801-15841823 CAGTGAGAACGCATGGACACAGG - Intergenic
1201641284 Y:16179715-16179737 CAGTGAGAACGCATGGACACAGG + Intergenic
1201661531 Y:16405607-16405629 CAGTGAGAACGCATGGACACAGG - Intergenic
1202093081 Y:21214462-21214484 TTGTGTGGAAGTAGGGAAACAGG + Intergenic
1202104088 Y:21343706-21343728 CTATGTGAACAAAGGGAATCAGG + Intergenic
1202238237 Y:22737580-22737602 CTATGTGAACAAAGGGAGACAGG - Intergenic