ID: 1135422081

View in Genome Browser
Species Human (GRCh38)
Location 16:22312124-22312146
Sequence TCATCACCACAAAAAGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135422081_1135422083 3 Left 1135422081 16:22312124-22312146 CCTGGTTCTTTTTGTGGTGATGA No data
Right 1135422083 16:22312150-22312172 TGTTCTAAAATTGGTTGTGCTGG No data
1135422081_1135422082 -6 Left 1135422081 16:22312124-22312146 CCTGGTTCTTTTTGTGGTGATGA No data
Right 1135422082 16:22312141-22312163 TGATGAGAATGTTCTAAAATTGG 0: 2
1: 33
2: 130
3: 251
4: 777

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135422081 Original CRISPR TCATCACCACAAAAAGAACC AGG (reversed) Intronic
No off target data available for this crispr