ID: 1135422082

View in Genome Browser
Species Human (GRCh38)
Location 16:22312141-22312163
Sequence TGATGAGAATGTTCTAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1193
Summary {0: 2, 1: 33, 2: 130, 3: 251, 4: 777}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135422075_1135422082 27 Left 1135422075 16:22312091-22312113 CCAGGGACTAGTGGGAGAGTGGA No data
Right 1135422082 16:22312141-22312163 TGATGAGAATGTTCTAAAATTGG 0: 2
1: 33
2: 130
3: 251
4: 777
1135422081_1135422082 -6 Left 1135422081 16:22312124-22312146 CCTGGTTCTTTTTGTGGTGATGA No data
Right 1135422082 16:22312141-22312163 TGATGAGAATGTTCTAAAATTGG 0: 2
1: 33
2: 130
3: 251
4: 777

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135422082 Original CRISPR TGATGAGAATGTTCTAAAAT TGG Intronic
901133196 1:6975743-6975765 CGATTAAAATGTTTTAAAATTGG - Intronic
901250456 1:7774500-7774522 TGATGAAAAAGTTCTGAAAATGG - Intronic
901555919 1:10031418-10031440 TGATGAAAATGTTCTGAAATTGG + Intergenic
901676178 1:10886969-10886991 TGATGGAAATGTTCTAAAATTGG + Intergenic
901742140 1:11349017-11349039 TTTTGAGAATGTTCTATAAACGG + Intergenic
902184144 1:14712446-14712468 TGATGAGAATGGTGTAATTTCGG - Intronic
902204509 1:14857894-14857916 TGATGAAAATGCTCTAAAATTGG - Intronic
902266885 1:15273622-15273644 TGATGGCAATGTTCTGAAAGTGG - Intronic
902616572 1:17626705-17626727 TGATGAGAAAGTTCTGGGATGGG - Intronic
902891285 1:19445747-19445769 TGATGGAAATGTTCCAAAATTGG + Intronic
902927588 1:19706885-19706907 TGATGGAAATGTTCTAAAATTGG + Intronic
904147315 1:28403673-28403695 TAATTAAAATGTTCTAAAATTGG - Intronic
904818837 1:33227082-33227104 TGATAAGAATGTTCTAAAATTGG + Intergenic
905138890 1:35824878-35824900 TGATGAAAAAGTTCTGAAAATGG - Intronic
905287715 1:36894113-36894135 TGATGGGAAGGTTCTAAAACAGG - Intronic
905394649 1:37659215-37659237 TGATGGAAAGGTTCTAGAATTGG + Intergenic
905646797 1:39630452-39630474 TGAAAAGAATGTTCTAGATTTGG - Intronic
905660967 1:39724641-39724663 TGATGAAAATGTTCTAAAGCTGG - Intronic
905672404 1:39800485-39800507 TGATTGAAATATTCTAAAATTGG - Intergenic
906160300 1:43643612-43643634 TGATGGAAATGTTCCAAAACTGG + Intergenic
906395057 1:45455643-45455665 TGATGAGAAAGTTCTGGAAAAGG + Intronic
906466395 1:46084307-46084329 TAATGAAAATATTCCAAAATTGG + Intronic
906724181 1:48031804-48031826 TGATGAAAATGTTCTGGAAATGG + Intergenic
906762154 1:48385337-48385359 AGATGAGAATGATCTGAAAAAGG + Exonic
906911128 1:49952054-49952076 TGATGAAAATGTTCTGGAAATGG + Intronic
906945913 1:50294109-50294131 TGGTGAAGATGATCTAAAATAGG - Intergenic
907219709 1:52897339-52897361 TGAGAAGAACCTTCTAAAATTGG + Intronic
907301948 1:53492708-53492730 TGATGAAAATGATCTAAAATTGG - Intergenic
907632429 1:56095957-56095979 TGAAGAAAATATTCTAGAATGGG + Intergenic
909153006 1:72032516-72032538 AGACTATAATGTTCTAAAATGGG + Intronic
909179138 1:72398582-72398604 TGATAAAAATGTTATGAAATTGG - Intergenic
909519927 1:76555970-76555992 TGATAAAAATGTTCTAAAATTGG - Intronic
909653930 1:78008631-78008653 TGATGGAAATGTTCTATAACTGG + Intronic
910050061 1:82962944-82962966 TCATGGGTATGTTATAAAATAGG - Intergenic
910155278 1:84210608-84210630 AAATGAGAATCTTCTAATATTGG - Intronic
910212274 1:84805643-84805665 TGAAGAAATTGTTCTAAATTAGG - Intergenic
910587412 1:88894750-88894772 TGATGGAAATGTGCTAAAACAGG - Intergenic
911241604 1:95473769-95473791 TAATGAGAAGCTTCTAAAACTGG - Intergenic
911258348 1:95658365-95658387 TGATGAAAATATTCTAAAACTGG + Intergenic
911499807 1:98671632-98671654 AGATGAAAATGTTCTAAAACTGG - Intronic
911620743 1:100064472-100064494 TGATGGAAATGTTCTATAACTGG - Intronic
912052902 1:105553093-105553115 TGATGAGGGTGATGTAAAATGGG + Intergenic
912077025 1:105887809-105887831 TGATGTAAATCTTCTAAAACTGG - Intergenic
912230272 1:107785101-107785123 TGAAGAGAATAGTTTAAAATGGG - Intronic
912252256 1:108023808-108023830 TGATCACAATGTTCCACAATAGG + Intergenic
912272022 1:108221140-108221162 TTATGAGGATGTTCTAGTATAGG + Intergenic
912278940 1:108292547-108292569 TAATGGAAATGTTCTAAAAATGG - Intergenic
912289286 1:108401810-108401832 TAATGGAAATGTTCTAAAAATGG + Intronic
912862091 1:113222992-113223014 TGATATGAACATTCTAAAATCGG + Intergenic
913026588 1:114849247-114849269 TGATGAAAGTGTTCTAAGAGAGG - Intergenic
913257553 1:116967517-116967539 TCATGAAAATGTTCTAAAACTGG - Intronic
913426968 1:118743226-118743248 TGATGAGAATGTGGAAAAAAAGG + Intergenic
913545548 1:119865545-119865567 TGAAGAAACTGTTCTAAAACTGG - Intergenic
914410341 1:147421363-147421385 TGACGAGAATGTGAAAAAATTGG - Intergenic
914474240 1:148010109-148010131 GGGTGGGAATGTTCTATAATAGG + Intergenic
914773883 1:150718145-150718167 TGAAGAAAATGTTATGAAATTGG - Intronic
915144031 1:153784035-153784057 TGACAAAAATGTTCTAAATTAGG - Intergenic
916094095 1:161332931-161332953 TGATGAAAACATTCTAAAATTGG - Intronic
916185536 1:162128959-162128981 TAATGAGAATCTCCTAAAACTGG - Intronic
916725842 1:167522795-167522817 TGATGAACATGTTCTAGAATTGG + Intergenic
916840260 1:168593281-168593303 TGATGGAAATGTTCTGAAACTGG - Intergenic
917009254 1:170452378-170452400 TGAAGAGGATGTTGTGAAATAGG - Intergenic
917447772 1:175121192-175121214 TGATGAAAGTATTCTATAATCGG - Intronic
917571425 1:176269464-176269486 TAATGAAAATATTCCAAAATTGG - Intergenic
917687014 1:177426768-177426790 TGATTTGAATTTTCTAAAAGAGG - Intergenic
917758440 1:178128635-178128657 TAATGGAAATGTTCTAAAACTGG - Intronic
917808982 1:178639109-178639131 AGATGAAAATGTTCTAAGACTGG - Intergenic
918029919 1:180797057-180797079 TGACAGAAATGTTCTAAAATTGG + Intronic
918030430 1:180802619-180802641 TGATGAAAATGTTCCAGAATTGG - Intronic
918384166 1:183988438-183988460 TGATGGAAATGTTCTGGAATTGG - Intronic
918908861 1:190538078-190538100 TGAAGAGAATAATCTAAACTGGG + Intergenic
919059959 1:192619798-192619820 TGATGGATATGTTCTAAAATTGG + Intergenic
919246527 1:194994654-194994676 TGTTGAAAATGTTCAAATATTGG - Intergenic
919406765 1:197194674-197194696 TCATGAGATTTTTCTAAATTTGG - Intronic
919960416 1:202462074-202462096 AGGTGAGCATGTTTTAAAATCGG + Intronic
920161251 1:203999409-203999431 TGGTGATAATGTTATAAAACAGG - Intergenic
920268946 1:204748501-204748523 TGATGAAAATGTTCTGGAACTGG + Intergenic
920989025 1:210918118-210918140 TGATGAGACTGTTGCAAAAAAGG + Intronic
921039047 1:211412065-211412087 TGATGGAAATGTTCTGAAACTGG + Intergenic
921234129 1:213107247-213107269 TAATGGAAATGATCTAAAATTGG - Intronic
921739053 1:218662931-218662953 TGATGGAAAAGTTATAAAATTGG - Intergenic
921900374 1:220443955-220443977 TGATGAAAATGTTCTGGAAATGG - Intergenic
922429907 1:225541132-225541154 GGTTAAAAATGTTCTAAAATTGG + Intronic
922553900 1:226518536-226518558 TGATGGAAATGTTCTAAAACTGG + Intergenic
923063775 1:230499855-230499877 TGATGAAAATGTTCTAAAATTGG - Intergenic
923582816 1:235234450-235234472 TGATGAGATTGCTGTAAAAAAGG - Exonic
923690280 1:236185859-236185881 TGATGAAAGTGTTCTAAAATTGG - Intronic
924047955 1:240051855-240051877 TGATAAAAATGTTCTAAAATTGG - Intronic
924391319 1:243562364-243562386 TGATGAAAATATTCTGGAATTGG + Intronic
924433437 1:244017388-244017410 TGATGAAAATGTTCTAAAATTGG + Intergenic
924499820 1:244626768-244626790 TGAAGAGAGTGCTCTAAATTAGG + Intronic
924695278 1:246393142-246393164 GAAGGAAAATGTTCTAAAATAGG + Intronic
1063349362 10:5340001-5340023 TGATGAAAATATCCTAACATTGG + Intergenic
1064134963 10:12742531-12742553 TGATGAAAACGTTCTGAAACTGG - Intronic
1064448818 10:15423127-15423149 TAATGAAAAGGTTCAAAAATTGG + Intergenic
1064668119 10:17678722-17678744 TGATGAAAAAGTTCTGAAAATGG - Intronic
1064835713 10:19527814-19527836 TGAAGATAATGTTTTAAAGTTGG + Intronic
1065054036 10:21825161-21825183 TGATGAGAAGGTTCTAGAGATGG - Intronic
1065062885 10:21925825-21925847 TGATGTAAATGTTCTAAAACTGG + Intronic
1065066152 10:21967147-21967169 TGATGAAAGTATTCTAAAACTGG - Intronic
1065069490 10:22007751-22007773 ATGTGAAAATGTTCTAAAATTGG + Intergenic
1065212166 10:23414768-23414790 TGATGAAAATGTTCTAAAATTGG - Intergenic
1065531338 10:26673164-26673186 GGATAAAAATGTTTTAAAATTGG + Intergenic
1065556354 10:26919535-26919557 GGATAAAAATGTTTTAAAATTGG - Intergenic
1065824746 10:29560281-29560303 TCATGAACATGTTCTAAAACTGG + Intronic
1067915965 10:50399067-50399089 CGATGGAAATGTTCTAAAACTGG + Intronic
1068223478 10:54074827-54074849 TGATGAGGATGTGGAAAAATTGG - Intronic
1068824966 10:61426312-61426334 TGATGGGAATGTTCTAAACCTGG + Intronic
1068931962 10:62599931-62599953 TGATGGAAATGTTCTAAAACTGG + Intronic
1069550071 10:69357894-69357916 TAATGAAAATGTTATAAAATTGG + Intronic
1069689700 10:70341995-70342017 TAATAAAAATGTTCTAAGATTGG + Intronic
1069749810 10:70737886-70737908 TGATAAAAATATTCTCAAATTGG + Intronic
1070086565 10:73243639-73243661 TGGTGAAAATGTCCTACAATTGG + Exonic
1070176407 10:73973897-73973919 TGATAAAAATATTCCAAAATTGG + Intergenic
1070229750 10:74552492-74552514 TGATGTAAATGTTCTAAAACTGG + Intronic
1070314608 10:75298054-75298076 TGATGGAAATGTTCTAAAACTGG - Intergenic
1070520830 10:77251772-77251794 TGATGAAAATGTTCTGAAACTGG - Intronic
1070767841 10:79066968-79066990 TCAGAAGGATGTTCTAAAATGGG + Intergenic
1071036618 10:81254990-81255012 TAATGAAAATACTCTAAAATTGG - Intergenic
1071793464 10:88980905-88980927 TGCTGAGAAAGTTCTAAATTTGG + Intronic
1072365864 10:94708681-94708703 TGATGGAAATGTTCTGAAATTGG - Intronic
1073666007 10:105534584-105534606 TGATGAACATGTAGTAAAATGGG + Intergenic
1074000133 10:109363688-109363710 TGATCAGTGTGTTCTAAAACTGG + Intergenic
1074057073 10:109932185-109932207 TGATAAAAATGTCCTAAAATTGG - Intergenic
1074349314 10:112719845-112719867 TGATAAAAATGTTCTACAATTGG - Intronic
1074412259 10:113238508-113238530 TAATGAAAATGTTATGAAATCGG + Intergenic
1074478001 10:113790303-113790325 TGATTAAAATATTCTGAAATTGG + Intergenic
1074560369 10:114530083-114530105 TGATGGAAATGTTCTAAAGTAGG + Intronic
1074656346 10:115592459-115592481 TGATGAAAATGTTCTAAAACTGG - Intronic
1075034954 10:119057320-119057342 TGCTCAGAAAGTTTTAAAATTGG - Intronic
1075046642 10:119151459-119151481 TGATGAAAATGTTCTACAACTGG + Intronic
1075246431 10:120826424-120826446 AGAAGAGAATGTTCTAGATTAGG + Intergenic
1075518655 10:123130297-123130319 TGATGAAAATGTTTTAAAATTGG - Intergenic
1075760759 10:124854489-124854511 TGATAAGGATGTTATAAAAAAGG - Intergenic
1075820464 10:125303882-125303904 TGATGGAAAAGTTCTAAAACTGG + Intergenic
1075943872 10:126415347-126415369 GGATGAGAAAGTTATAAACTTGG + Intergenic
1076025564 10:127109483-127109505 TTATAAAAATGTTCTAAAATTGG - Intronic
1076113533 10:127879664-127879686 TGATCAAAATATTCTAAAATTGG + Intronic
1076383641 10:130041482-130041504 TGGTGAGGATGTTGGAAAATAGG - Intergenic
1076908573 10:133376103-133376125 TGATGAAAATGTCCTAAACTTGG + Intergenic
1077447347 11:2603466-2603488 TGATAAAAATGTTCTCAAACTGG - Intronic
1078058110 11:8023949-8023971 TGAAGAGAAGGGTCTAGAATGGG - Intronic
1078116383 11:8456090-8456112 TGATAAGATTATTCTCAAATGGG - Intronic
1078129289 11:8599644-8599666 TGGTGAGAATGTGCAGAAATTGG + Intergenic
1078354181 11:10622002-10622024 TGATGAAAACGTTCTAGAAATGG + Intronic
1078676717 11:13425228-13425250 GAATTAGAAGGTTCTAAAATGGG + Intronic
1078815706 11:14820500-14820522 TGTTGAGAATGTTCTAAAATTGG + Intronic
1079049464 11:17140700-17140722 TGATGAGAATGTTCTAAAACTGG + Intronic
1079563881 11:21856771-21856793 TGAGTACATTGTTCTAAAATGGG - Intergenic
1079605731 11:22363621-22363643 TGATGAGAACATTTCAAAATGGG - Intronic
1079815614 11:25053498-25053520 AGATGAAAATGTTCTGAAACTGG - Intronic
1080113327 11:28594201-28594223 TGATGGAAATGTTCTAAAACTGG + Intergenic
1080327808 11:31098557-31098579 TGATGCATATGTTTTAAAATTGG - Intronic
1080517004 11:33033064-33033086 TGAGGAGAATGTTTTAAATTTGG - Intronic
1080636504 11:34128781-34128803 TGATAAAAATGTTCTAAAATTGG - Intronic
1080869849 11:36227642-36227664 TGATAGGAATGTTCCAAAACTGG + Intronic
1080956470 11:37102274-37102296 GGTTGAGAATTTTCTAAAATTGG - Intergenic
1080957319 11:37114461-37114483 TGTTGGAAATGTTCTAAAATTGG + Intergenic
1080972729 11:37298803-37298825 TGTTGAGAATGATCTTAACTGGG + Intergenic
1081074775 11:38657619-38657641 TGGTCAGAATGGTCTAAAATTGG - Intergenic
1081182351 11:39999594-39999616 TAATGAAAATGTTCTAAATGTGG - Intergenic
1081198567 11:40190816-40190838 TGATGACAATGATAGAAAATTGG + Intronic
1081233169 11:40611889-40611911 TGATGAGAATGTGGAGAAATTGG + Intronic
1081424434 11:42909891-42909913 TGATAAGAATCCTCTAAACTTGG - Intergenic
1082786647 11:57320803-57320825 AGATGTGAATATTCTTAAATCGG - Intronic
1082887779 11:58106125-58106147 TGGTGAGAAAGTACAAAAATTGG - Intronic
1084098136 11:66926656-66926678 TGATGAAAAGGTTCTGGAATTGG - Intronic
1084416265 11:69034552-69034574 TGATGAGAACATTCTGAAATTGG - Intergenic
1084802132 11:71551730-71551752 TGATGAGAATGTGGAGAAATGGG + Intronic
1085031911 11:73276758-73276780 TTATTAAAATGTTCTGAAATTGG + Intronic
1085185923 11:74576174-74576196 TGATGGAAGTGTTCTAAGATTGG + Intronic
1085191123 11:74623533-74623555 TGATGAAAATGCTCTAAAATTGG + Intronic
1085275796 11:75299120-75299142 TGATGAAAATGTTCTGGAATTGG + Intronic
1085764961 11:79274684-79274706 TGATGAGTCTGTTATAAATTGGG + Intronic
1086191669 11:84086783-84086805 TGATGAAAATGTTCTAGGCTGGG - Intronic
1086236021 11:84631719-84631741 TGAAAAGAAAGTTTTAAAATGGG + Intronic
1086730034 11:90237519-90237541 TTAATAGAATGTTTTAAAATGGG + Intergenic
1086853863 11:91843367-91843389 TCATGAGATTGTTATAAAGTAGG - Intergenic
1087003735 11:93447350-93447372 TGAAGGTAATGTTCTAAAATTGG - Intergenic
1087109849 11:94452925-94452947 TGATGAGAAAGTTCTATAGATGG - Intronic
1087184699 11:95176415-95176437 TGATGGGAAAGATCCAAAATGGG + Intronic
1087257192 11:95969261-95969283 TGAAGAAAATGCCCTAAAATTGG - Intergenic
1087279826 11:96197897-96197919 GGAGGAGAGTGTTCTAAAAGAGG + Intronic
1087409025 11:97767075-97767097 TCATGAGAATCTTGTAACATAGG - Intergenic
1087589060 11:100161295-100161317 AGATGAAAATGTTCTAAATGAGG + Intronic
1088677603 11:112211042-112211064 TGATGAAAATGTTCTGGAAATGG - Intronic
1089056216 11:115587324-115587346 TGATGAAAACATTCTAAAATTGG - Intergenic
1089288680 11:117424263-117424285 TGATGAGAAAGTTCTGGAAATGG + Intergenic
1089677651 11:120100564-120100586 TAATGAAAATGTTCTAAAATCGG - Intergenic
1089922478 11:122222889-122222911 TGATAGGAATGTTCTAAAACTGG - Intergenic
1090000470 11:122952197-122952219 TGATGAAAATGTTCTAAAATTGG + Intronic
1090410641 11:126507239-126507261 TGATGAAAATGTTCTAATACTGG + Intronic
1090491961 11:127172226-127172248 CGATGAAACTGTTCTAAAACTGG - Intergenic
1090784653 11:130038617-130038639 TGATGGAAATGTTCTAAAATTGG + Intergenic
1091405805 12:208745-208767 TGATGAAAATGTTCCAAAAGTGG + Intronic
1091551356 12:1537512-1537534 TGCTGAGAACGTTCTGAATTTGG - Intronic
1092621241 12:10271794-10271816 TCATAAGAAAGTTTTAAAATTGG + Intergenic
1092753904 12:11744960-11744982 TAATTAAAATGTTTTAAAATGGG + Intronic
1092771366 12:11900007-11900029 TAATGGAAATGTTCTAAAATTGG + Intergenic
1092802322 12:12181850-12181872 TGATAGGAATGTTCTAAAATTGG + Intronic
1092877291 12:12859330-12859352 TGATGAAAATGTTCTAAAACTGG - Intergenic
1093068952 12:14688387-14688409 CAATGAAAATGTTCTAAAACTGG - Intronic
1093316444 12:17656980-17657002 TAATGAAAATGGTCTAAAATTGG - Intergenic
1093879595 12:24388700-24388722 TGACGAAAGTGTTCAAAAATTGG - Intergenic
1093946466 12:25115351-25115373 GGATAAAAATGTTCTAAAACTGG - Intronic
1093969865 12:25365303-25365325 TGATGAAAATGTTCTAAAACTGG + Intergenic
1094016726 12:25872240-25872262 TGATGAAAATGTTCTAAAATTGG + Intergenic
1094073275 12:26443466-26443488 ATATGAAAATGGTCTAAAATAGG + Intronic
1094552607 12:31466784-31466806 AGTTGAGAATTTTCCAAAATGGG + Intronic
1095045792 12:37502868-37502890 TGATGACAATGTAATAAAACTGG + Intergenic
1095438682 12:42220080-42220102 TTATGAGAAGGCCCTAAAATGGG + Intronic
1095684693 12:45020132-45020154 TGATGAAAATGTTCTAAAATTGG - Intronic
1095864296 12:46954796-46954818 TGATGAGAAGCTGCTAAGATGGG + Intergenic
1095908856 12:47405518-47405540 TGATGAAAATGTTCTCACACTGG - Intergenic
1095921889 12:47540191-47540213 AGAAGAGAATGTGCTAGAATAGG + Intergenic
1096161336 12:49379921-49379943 TGATGAAAAAGTTCTGAAATAGG - Intronic
1096205967 12:49722150-49722172 TGTTGTGAATGTTCTGAATTTGG + Intronic
1096377924 12:51129812-51129834 GGATAAAAATGTTCTAAAACTGG + Intronic
1096554023 12:52392171-52392193 TGATGAAAATGTTCTAAAATTGG - Intergenic
1097713645 12:62941788-62941810 TAAGGAGAATGTATTAAAATAGG - Intergenic
1097976745 12:65694501-65694523 TAATAAAAATGTTTTAAAATGGG - Intergenic
1098049966 12:66443083-66443105 TGAAGACAATTTTCTTAAATGGG + Intronic
1098876968 12:75875974-75875996 TGGTGGGAATGTAGTAAAATGGG + Intergenic
1099260620 12:80376260-80376282 TGTTGAGATTGTTTTAAATTAGG + Intronic
1099754621 12:86828895-86828917 TGATGAAAATATTCTAAACCTGG + Intronic
1099945072 12:89234737-89234759 TGATGAGAATCTTCTACCTTGGG - Intergenic
1099996519 12:89785223-89785245 TGATGAGGAAAATCTAAAATGGG + Intergenic
1100091815 12:90982379-90982401 TGATGAAAATGCTATAAAATTGG - Intronic
1100180238 12:92077547-92077569 AGATGAGATTGTTCTAGAAGTGG + Intronic
1100441874 12:94624838-94624860 TGATGAAAATGTTCGAAAATGGG + Intronic
1100578966 12:95920751-95920773 TAGTGAAAATGTTCTAAAATTGG + Intronic
1100617625 12:96243255-96243277 TAATGAAAATGTTCTAAAGTGGG - Intronic
1100666591 12:96760378-96760400 TGATGAAAATGTTCTAAAACTGG - Intronic
1100864505 12:98842470-98842492 TTATGGAAATGTTCTAAAATGGG + Intronic
1101076132 12:101131465-101131487 TGTTGAAAATATTATAAAATTGG - Intergenic
1101186026 12:102280623-102280645 TGATCACAAGGTTCTACAATAGG + Intergenic
1101476761 12:105057836-105057858 TGATGAAAATGTTCCAAAATTGG + Intronic
1101864181 12:108507800-108507822 TAATGAAAATGTTCTAAAATTGG + Intergenic
1101932734 12:109028027-109028049 TGAGGAGAATGTGCAGAAATTGG - Intronic
1102290538 12:111695711-111695733 TGATAAGAATATACTAGAATTGG + Intronic
1102306445 12:111808299-111808321 TGATGCAGATGTTCTAAAACTGG + Intronic
1102480137 12:113217447-113217469 TGATAGAAATGTTCTAAAACTGG - Intronic
1102582933 12:113902995-113903017 TAATGAAAATCTTCTAAAATTGG - Intronic
1102624876 12:114226884-114226906 TGAAGAGCATGTTCTAGGATGGG + Intergenic
1102641963 12:114374646-114374668 TGATGGGAATGTTCTATATTTGG + Intronic
1103178042 12:118881506-118881528 TGATGAGAATGTTCTGGAATTGG - Intergenic
1103423022 12:120805124-120805146 GGATGATAATGTGCTAAAATTGG + Intronic
1103793302 12:123486596-123486618 TGAAGAAAATGTTCTAGAACTGG - Intronic
1104045074 12:125156443-125156465 TGATGAAAAGGTTCTAGAAATGG + Intergenic
1104252854 12:127112514-127112536 TGATGAAAAGGTTCTGAAAATGG + Intergenic
1104298291 12:127539253-127539275 TGAAGAAAATGTTGGAAAATGGG - Intergenic
1104298799 12:127543593-127543615 TGACAAAAATGTTGTAAAATTGG - Intergenic
1104339111 12:127930590-127930612 TAATGAAAATGTTCTAAAATTGG + Intergenic
1104425507 12:128674083-128674105 TGACAAAAATGTTATAAAATCGG - Intronic
1104485449 12:129148184-129148206 TGAGGAGCTTGTCCTAAAATTGG + Intronic
1105267444 13:18835103-18835125 TGATGGAAATGCTCTAAAGTTGG - Intergenic
1105374056 13:19827135-19827157 TGATGAAAATGTTCTAAGATTGG + Intronic
1105500009 13:20963724-20963746 TGATGCAAATATTCTAAAATTGG + Intergenic
1105649127 13:22354841-22354863 TGATGAAAAAGTTCCAAAATTGG + Intergenic
1105758023 13:23487595-23487617 TGATAGGTGTGTTCTAAAATTGG + Intergenic
1105900768 13:24750407-24750429 TGATGAAAATGTTCTAAAGTTGG - Intergenic
1105951704 13:25234946-25234968 TGATGGAAATGTTCTAAAATGGG + Intergenic
1105998885 13:25700357-25700379 TGATGAAAATATTCTAAAATTGG - Intronic
1106047504 13:26157122-26157144 TAATGAAAATGTTCTAAAATTGG + Intronic
1106587009 13:31066523-31066545 TCATGGAAATGTTCTAAAATTGG - Intergenic
1107597831 13:41981490-41981512 TGATGAAAATCTTCTGGAATTGG + Intergenic
1108122079 13:47199902-47199924 GGATAAAAATGTTCTACAATTGG - Intergenic
1108790110 13:53959803-53959825 TAATAGAAATGTTCTAAAATTGG - Intergenic
1109341605 13:61068213-61068235 TAATGAGTATGTTTCAAAATTGG - Intergenic
1109462339 13:62678137-62678159 TCATGAGATTGTAGTAAAATTGG + Intergenic
1109627019 13:64987998-64988020 AGAGAACAATGTTCTAAAATTGG + Intergenic
1109787353 13:67195874-67195896 TGATAAAAATGTTTTAAAACTGG + Intronic
1110058163 13:71004429-71004451 AAATGTGAATGTTCAAAAATTGG - Intergenic
1110609509 13:77473540-77473562 TGATGATAATTTTGTAAAGTTGG - Intergenic
1110645459 13:77878321-77878343 TGATGAGAATGTTCTAAAAATGG - Intergenic
1110798317 13:79666037-79666059 TGATGGAAATGTGCTAAAACAGG - Intergenic
1110811267 13:79812952-79812974 TGATAAAAATGTTCTAATTTTGG - Intergenic
1110945870 13:81415665-81415687 TAATGAAAATGTTCCAAAATTGG - Intergenic
1111024136 13:82497064-82497086 TGAAGAAAATATTTTAAAATTGG - Intergenic
1111538554 13:89638468-89638490 TGATGTGAATGTACTAAAACTGG - Intergenic
1111880256 13:93947305-93947327 TTATGTGAATGTTCTAAGTTAGG - Intronic
1112444923 13:99455253-99455275 TGATGAGAATGTTCTCAAATAGG + Intergenic
1112558417 13:100490664-100490686 TGATGGAAATGTGCTAAAACTGG - Intronic
1112607247 13:100919046-100919068 TGATGAAAAAGTTCTAGAAATGG + Intergenic
1112732632 13:102382997-102383019 TGATGAAAATATTCTAGAATTGG + Intronic
1112841665 13:103586942-103586964 TGATGACAATGTCCCACAATAGG + Intergenic
1113037580 13:106067919-106067941 TGATAAAAATGGTCTATAATCGG + Intergenic
1113128790 13:107011205-107011227 GGATGAAAATGTTCTAAATCTGG - Intergenic
1113247026 13:108408441-108408463 TAATGAGAATGTTCTGGAATTGG + Intergenic
1113949382 13:114063052-114063074 AGATGAAAATGTTCTAAAATTGG + Intronic
1114279368 14:21177150-21177172 TGATAAAAACGTTCTAAAACTGG - Intergenic
1114373348 14:22114321-22114343 TGATGAAAATTTTGTAACATAGG + Intergenic
1115132500 14:30070815-30070837 TTATTAGAATTTTTTAAAATGGG - Intronic
1115193480 14:30771615-30771637 GGAGGGGAATGTTCTTAAATTGG + Intergenic
1115194651 14:30783206-30783228 TGATGGAGATGTTCTAAAACTGG + Intergenic
1115195100 14:30789727-30789749 TAATGAAGATGTTATAAAATAGG + Intergenic
1115273847 14:31584544-31584566 TAATGAAAATGTTCTCAAATTGG - Intronic
1115423427 14:33224619-33224641 GGAAGAAAATGTTCTAAACTAGG - Intronic
1115939660 14:38594294-38594316 TGATGAAAAACTTCAAAAATTGG + Intergenic
1116706496 14:48308894-48308916 TGAAGAGCATGTACTACAATTGG - Intergenic
1117054444 14:51897570-51897592 TGATGAAAAAGTTATTAAATGGG + Intronic
1117241818 14:53841585-53841607 TGCTGAGAATCTTCTAAATATGG + Intergenic
1117517332 14:56514800-56514822 TGATGAGAAAGTTCTAGAGATGG + Intronic
1117681086 14:58203456-58203478 TGATGAAAACATTCTAAAACTGG - Intronic
1117933271 14:60870838-60870860 TGATGAAAACATCCTAAAATTGG - Intronic
1117937087 14:60918820-60918842 TGATGAAAATGTTCTGAAATTGG + Intronic
1118048362 14:61997759-61997781 TTTCAAGAATGTTCTAAAATAGG - Intronic
1118268727 14:64321337-64321359 TGATGGAAATGTTCTAAACCTGG + Intronic
1118738451 14:68719795-68719817 TGATGAGAATGTAGAGAAATTGG - Intronic
1118775680 14:68972594-68972616 TGATGGAAATGTTCTGGAATTGG - Intronic
1119008504 14:70957666-70957688 TGATAAAAGTGGTCTAAAATTGG + Intronic
1119367638 14:74107965-74107987 TGATGAAAATGTTGTAAAATTGG - Intronic
1119614173 14:76087691-76087713 TGAGGAAAATGTTCTAGAACAGG - Intergenic
1119812692 14:77536190-77536212 TGATGAAAAGGTTCTATAAATGG + Intronic
1120325826 14:83024505-83024527 TGTTGAGAATATTAAAAAATTGG - Intergenic
1120419086 14:84259736-84259758 TGATGAAAATGTTCTAAAACTGG + Intergenic
1120662722 14:87269869-87269891 TGATGAGAATAGTCTAAAAGTGG + Intergenic
1120773355 14:88406334-88406356 TGATGAAAATGTTCTAAAATTGG - Intronic
1121190388 14:92023316-92023338 TTATGAGAATGTTCTCAAATTGG - Intronic
1121724213 14:96134679-96134701 TGATGAAAATGTTTTGGAATTGG + Intergenic
1122028723 14:98896915-98896937 TGGTGCAAATGTTCTAAAATTGG - Intergenic
1123679259 15:22746426-22746448 TAATTAGAATGTTTTAAAAATGG + Intergenic
1124095669 15:26646679-26646701 TGATGAGAATGTGTAGAAATTGG - Intronic
1124102613 15:26709896-26709918 TGATGGAAATTTTCTAAAACTGG - Intronic
1124331480 15:28820876-28820898 TAATTAGAATGTTTTAAAAATGG + Intergenic
1124366491 15:29075325-29075347 TGATAACCATGTTCTAAACTAGG + Intronic
1124428616 15:29586356-29586378 TGACAAAAAAGTTCTAAAATTGG + Intergenic
1125196170 15:37049334-37049356 TGATGAAAATGTCCTAAAATCGG + Intronic
1125571584 15:40723705-40723727 TGATGAAAATGCTCTAAAATTGG + Intronic
1125649190 15:41299731-41299753 TGATAAAAATGGCCTAAAATGGG + Intergenic
1125741583 15:41968879-41968901 TGATGAAAATGTTCTGAAATTGG - Intronic
1125830228 15:42710441-42710463 TAATGAAAATGTCCTAAAATTGG - Intronic
1125935120 15:43628397-43628419 TGATGGAAATGTTCTGGAATTGG - Intergenic
1126289325 15:47055622-47055644 TGATGACAATGTAATAAAACTGG - Intergenic
1126463114 15:48934977-48934999 TGATAAAAATGTTCTGTAATTGG + Intronic
1126492415 15:49252451-49252473 TGATGGTAATGTTCTAAAATTGG + Intronic
1126606739 15:50485617-50485639 TGACGGCAATGTTCTAAAATTGG - Intronic
1126609292 15:50512432-50512454 TAACGAAAATGTTCTAAAACTGG + Exonic
1126632750 15:50754438-50754460 TGATGAAAATGTTATAAAATTGG + Intronic
1126923419 15:53553664-53553686 TTATGAGAATTTTCTAAAAATGG + Intronic
1126931179 15:53653277-53653299 TCATGATAAAGTTATAAAATAGG + Intronic
1127176092 15:56359302-56359324 TGATGAAAAAGTTCTGAAAATGG - Intronic
1127222551 15:56895503-56895525 TGATGAAAATGCTTTTAAATTGG + Intronic
1127673480 15:61217831-61217853 TAATGAGCATGTGCTAAAAGTGG + Intronic
1128097472 15:64968591-64968613 TGATGAAAATGTTGTGAAAATGG + Intronic
1128438499 15:67679917-67679939 TGATGAAAATGTTCTAAAACTGG - Intronic
1128507215 15:68282065-68282087 TGTTAAGAATGTTATAAAAAGGG + Intronic
1128715797 15:69907052-69907074 TGATGAGAACGTTCTAAAACCGG + Intergenic
1129124716 15:73429043-73429065 TGAAGAGAATGTGGGAAAATGGG - Intergenic
1129647855 15:77454274-77454296 TGATGAAAATGTTCTAAAATTGG + Intronic
1129824046 15:78622641-78622663 TGATGCAGATGTTCTAAAACTGG + Intergenic
1130226992 15:82066617-82066639 TCCAGAGAATGTTCTAAAATAGG + Intergenic
1130329756 15:82912722-82912744 TGGTGAGAATGTGCACAAATTGG - Intronic
1131040414 15:89260084-89260106 TGATGAGGATGTGAAAAAATTGG - Intronic
1131297296 15:91161193-91161215 TGATGCAAGTGTTCTAAAACTGG + Intronic
1131303407 15:91219716-91219738 TGATGGGAATGTCCTAAAACTGG - Intronic
1131500346 15:92957763-92957785 TGAGGAAAATGTTCCAAAACTGG - Intronic
1131545694 15:93313840-93313862 TGTTTAGAATTTTCTCAAATGGG - Intergenic
1131659025 15:94493995-94494017 TAATAAGAATCTTCTAAAAATGG - Intergenic
1131776167 15:95801325-95801347 TGATGGAAATGTTCTAAAATTGG - Intergenic
1132033975 15:98464504-98464526 TGATGGAAATGTCCTAAAACTGG + Intronic
1132128105 15:99247826-99247848 TGATGAAAATTTTCTAAAATTGG + Intronic
1132395095 15:101466901-101466923 TGATGAAAATGTTATCAGATGGG + Intronic
1132417851 15:101636801-101636823 TGATGAGAATGTGGAGAAATTGG - Intronic
1132714305 16:1283286-1283308 CGATAAAAATGTTGTAAAATTGG - Intergenic
1133041584 16:3063697-3063719 TGATAAAAATGTTCTAAAATGGG + Intergenic
1133184876 16:4088910-4088932 TGATGAAAATGTTCTCGAATGGG - Intronic
1133217383 16:4301154-4301176 TAATGAAAATATTCCAAAATTGG - Intergenic
1133655914 16:7863554-7863576 TGTTGGGAATGTTCTAACACTGG + Intergenic
1133706012 16:8355323-8355345 TGATGAGAATGTGATAACACAGG + Intergenic
1133721324 16:8497136-8497158 TAATGAAAATGTTCTGGAATTGG - Intergenic
1133841645 16:9415548-9415570 AGAAGAGAAAGTTTTAAAATTGG + Intergenic
1134314362 16:13104744-13104766 TGCTGAAAATGTTCTAAAACTGG + Intronic
1134424959 16:14132327-14132349 AGATGAGAATGTTCTGGACTTGG + Intronic
1134796494 16:17041938-17041960 TGACGACAAAGTTATAAAATGGG + Intergenic
1135036549 16:19083008-19083030 TGATAAAAATGTTCTAGAATCGG + Intergenic
1135422082 16:22312141-22312163 TGATGAGAATGTTCTAAAATTGG + Intronic
1135469241 16:22714474-22714496 TGAAAAGAATTTTTTAAAATTGG + Intergenic
1135742656 16:24989645-24989667 TGACAAAAATGTTCTACAATTGG + Intronic
1135755021 16:25090000-25090022 TGATGAAAATGTTCCACAATTGG + Intergenic
1135878605 16:26229671-26229693 TGATGAAAGTGTTCTAGAACTGG + Intergenic
1136015632 16:27398918-27398940 TGATGGGATTGTTTTAAAATTGG + Intergenic
1136286868 16:29249280-29249302 CGATGAGATTGTTCTGAAGTAGG - Intergenic
1137795985 16:51220497-51220519 TGATGAAAATGTTCTAAAGATGG - Intergenic
1137991039 16:53155627-53155649 TAACGAAAATGCTCTAAAATTGG - Intronic
1138380380 16:56597284-56597306 TGATGGAAATGTTCTAAAACTGG - Intergenic
1138616322 16:58170177-58170199 TGATGGAGATGTTCTAAAACTGG - Intronic
1138937231 16:61742762-61742784 TGATGAGAATTTTACAAGATAGG - Intronic
1139077645 16:63472777-63472799 TGAAGAAAATGTTATATAATTGG + Intergenic
1139080762 16:63517331-63517353 TAATAAAAATATTCTAAAATTGG - Intergenic
1139138718 16:64235061-64235083 TGGAGAGAATGTTGTAAAACTGG - Intergenic
1139346912 16:66309703-66309725 TGATGAAAATGTTATAAAAGGGG - Intergenic
1139778639 16:69332589-69332611 TGATGGAAATATTCTAAAATTGG + Intronic
1140062770 16:71585820-71585842 TGATAACAAGGTTCTGAAATTGG - Intergenic
1140110365 16:71998907-71998929 TGATGAGAATGATATAATAATGG + Intronic
1140316368 16:73901844-73901866 TGATGTGAAAAATCTAAAATAGG - Intergenic
1140604436 16:76517758-76517780 TAATGACCATGTTCTAAAATTGG - Intronic
1140712468 16:77691305-77691327 TGATGAGAATGTAGTGGAATTGG - Intergenic
1141309026 16:82895141-82895163 TGATGAAAATGTTTTGAACTAGG - Intronic
1141534862 16:84672197-84672219 TGATGAAAATGTTCTAAAACTGG + Intergenic
1141610617 16:85179097-85179119 TGATGGGAATGTTCTGGAACTGG - Intronic
1141643586 16:85355599-85355621 TGATGAGAAAGTTCTAGAAATGG + Intergenic
1141767624 16:86069121-86069143 TGATGAAAATGCTCTAAAATTGG + Intergenic
1141892477 16:86935628-86935650 TGATGAAAATGTTCTAAAATTGG - Intergenic
1142092467 16:88221915-88221937 CGATGAGATTGTTCTGAAGTAGG - Intergenic
1142205662 16:88781814-88781836 TGGTGACAATGTTCTGAAAAAGG + Intronic
1142658596 17:1411658-1411680 TGATGGGAATGCTCTAAAATGGG - Intergenic
1142822162 17:2478584-2478606 TGATAGGAGTGTTCTAAAAGTGG - Intronic
1143726672 17:8852177-8852199 TGATGAGAAGGTTCTGGAAATGG + Intronic
1144096283 17:11903406-11903428 TGATATAAATGTTCTAAAACGGG + Intronic
1144648757 17:16992866-16992888 TGATGAACATGTTCTAGAATGGG - Intergenic
1146147076 17:30428771-30428793 TTATGAAAATGTTCTATAACTGG + Intronic
1146422599 17:32702300-32702322 TTATGAAAATATTCAAAAATAGG - Intronic
1146625055 17:34428762-34428784 TGATAAAAATGTTCTAAAGGGGG - Intergenic
1146909617 17:36640289-36640311 TTTTGACAGTGTTCTAAAATTGG - Intergenic
1146970660 17:37069025-37069047 TGATAAGAATGTCCTAAACATGG - Intergenic
1147222696 17:38948066-38948088 TGATGAAAATGTTCTAAAATTGG - Intronic
1147576579 17:41603926-41603948 TGATGAGCATGTTTTGAAATAGG + Intergenic
1147633934 17:41951030-41951052 TGATGGAAATGTTCTAAAATGGG + Intronic
1148146626 17:45369656-45369678 TGATGGCAATGTTATAAAACTGG + Intergenic
1148188643 17:45663190-45663212 TGAAGAAAATATTCTAAAATTGG - Intergenic
1148803484 17:50249845-50249867 TAATGAAAGTGTTCTAAAATTGG - Intergenic
1148927730 17:51102080-51102102 TGATTAGAAAGGTCTAACATGGG + Intronic
1149413473 17:56433312-56433334 TGATGAATAAGTTCTAAAACAGG - Intronic
1150320556 17:64210680-64210702 AAATGAGAATGCTCTAAAAATGG - Intronic
1150557145 17:66264611-66264633 TGATGAAAAGTTTCTAGAATTGG + Intergenic
1150792670 17:68211200-68211222 TGATGAAAATGTTCTGGAATTGG + Intergenic
1152165665 17:78703530-78703552 AGATGAAAATGTTCTAAAACTGG - Intronic
1152546942 17:81004784-81004806 AGATGAAAATGTTCTGAAATTGG - Intronic
1152999939 18:445560-445582 TGATGAAAATATTCTAAAATTGG - Intronic
1153295108 18:3537745-3537767 TGATGAGAATGTGGAGAAATAGG - Intronic
1154210161 18:12372934-12372956 TGCTGAAAATGTTCTGGAATTGG + Intronic
1154420965 18:14226316-14226338 TGATGGAAATGCTCTAAAGTTGG + Intergenic
1155330413 18:24710227-24710249 TGATGAAAATGTTTTAAAACTGG - Intergenic
1155752746 18:29449105-29449127 TTGTGGGAATTTTCTAAAATTGG - Intergenic
1156275397 18:35579201-35579223 TGATATAAATGTTCTAAAATTGG - Intergenic
1156324595 18:36062837-36062859 TAATAAAAATGTTCTAAAACTGG + Intronic
1156338994 18:36194187-36194209 GAATGAAAATATTCTAAAATTGG + Intronic
1157488144 18:48103993-48104015 TGATGAATATGTCCTAAAAATGG + Intronic
1157659642 18:49428777-49428799 GGATGATAATGTTCTAAAATTGG + Intronic
1157809832 18:50687127-50687149 TGATGAAAATTTTCTAAAATTGG - Intronic
1157852725 18:51072228-51072250 TGATGAGAATGTAGAGAAATTGG - Intronic
1157916072 18:51664989-51665011 TCAAGAGAATTTTCTAAAATAGG - Intergenic
1158103521 18:53858433-53858455 TGATGAGAATGTTTTAAAGCTGG + Intergenic
1158380469 18:56924588-56924610 TGATGAGAGAGTTCTACAAGAGG + Intronic
1158515371 18:58126231-58126253 TGATGAAAATTTTCTAAAATTGG - Intronic
1158923408 18:62221962-62221984 TAATAATAAAGTTCTAAAATTGG - Intronic
1159375789 18:67591077-67591099 TGATGAGGATTTTTAAAAATGGG + Intergenic
1159468691 18:68821031-68821053 TGGTTAGAATGTTCTAAATGAGG + Intronic
1159687459 18:71440825-71440847 TGATAAGCATGTGCAAAAATAGG + Intergenic
1160020414 18:75176249-75176271 TGTTGACAATGTCCTAAATTAGG - Intergenic
1160052748 18:75451387-75451409 TGAAGAAAATGTTCTAAAACTGG - Intergenic
1160138916 18:76301480-76301502 TGGTGAGAATGTGGGAAAATGGG + Intergenic
1160181136 18:76637782-76637804 TGAACAGAATGTTCTATAAATGG + Intergenic
1160230627 18:77046254-77046276 GCCTGAGAATGTTCTAGAATAGG - Intronic
1161025364 19:2034211-2034233 TGATGAGAATGTTGCAGAATTGG + Intronic
1161191892 19:2962111-2962133 TGATGGAAATTTTCTAAAATTGG + Intergenic
1162313062 19:9918911-9918933 TGATGAAAATGTCCTAAAATTGG + Intronic
1162451743 19:10759206-10759228 TGATGAAAATGTTCTACATCTGG - Intronic
1162521347 19:11181652-11181674 AGATGAGAAAGTTCTAAAGATGG + Intronic
1162912351 19:13855145-13855167 TGATGGAAATGTTCTAAAGTTGG - Intergenic
1163052680 19:14696282-14696304 TGATGAAAATGTTCTGGAATTGG - Intronic
1163273431 19:16267767-16267789 TGATTAAAATGTTCTCAAACAGG + Intergenic
1163332549 19:16650018-16650040 TGATGAAAATGTTCTGAAATTGG + Intronic
1163589725 19:18185702-18185724 TGATGAGGATGGGCTACAATTGG - Intergenic
1163751240 19:19079354-19079376 TGATGAAAATGTTCTGAAATTGG - Intronic
1164619770 19:29687715-29687737 TGATGAAACTGTTCTGAAATTGG - Intergenic
1165011751 19:32853335-32853357 TGATGGAAATGATCTAGAATTGG + Intronic
1165338008 19:35186601-35186623 TGATAAAAATATTTTAAAATTGG - Intergenic
1165754097 19:38281804-38281826 TGATGAAAATGTTCTAAAATTGG - Intronic
1166116902 19:40661944-40661966 TGATGGAAATGTTCTTGAATTGG + Intergenic
1166771127 19:45283064-45283086 TAATGAAAATGTTCTGAAATCGG - Intronic
1166815105 19:45539939-45539961 TGATGGAAATGTTCTGAAATTGG + Intronic
1166978427 19:46618735-46618757 TGATGAAAATGTTCTGGAATTGG - Intergenic
1167014919 19:46834893-46834915 TGATAAAAATATTCTAAAATGGG + Intergenic
1167585278 19:50371173-50371195 TGACCAAAATGTTCTAAAATTGG + Intronic
1168448330 19:56443157-56443179 TGATAAAAATGTTCTAATACTGG + Intronic
1168639900 19:58024229-58024251 TGATGAAAATGTTCTCAAATTGG + Intergenic
1168715932 19:58527369-58527391 TGATGGAGATGTTCTAAAACAGG - Intronic
925199328 2:1953360-1953382 GGATGAGAATGATGGAAAATGGG - Intronic
925963188 2:9038185-9038207 TGATGAAAATGATCTAAAACTGG + Intergenic
926470442 2:13248886-13248908 TGATGAGATTGTTCTAAAACTGG - Intergenic
927144326 2:20151782-20151804 TGATGAAAATGTTCTAGAAGTGG - Intergenic
927621985 2:24670725-24670747 TGATGAGAATATTCTAAAATTGG + Intronic
927767047 2:25820643-25820665 TGATGAAAACATTCTAAAACCGG + Intronic
928164170 2:28957548-28957570 TGATGATGATTTTTTAAAATTGG + Intronic
928232513 2:29511215-29511237 TGATGGAAATGTTCTATATTTGG - Intronic
928333531 2:30376116-30376138 TGATGAAAATGTTCTAGAAATGG - Intergenic
928412856 2:31067755-31067777 TCATTAAAATGTTATAAAATGGG + Intronic
929138237 2:38644948-38644970 TGATGGAAATATTCTAAACTTGG + Intergenic
929734089 2:44526987-44527009 TGATGAAAATGCTCTATAATTGG - Intronic
929932143 2:46266290-46266312 TGATGAAAAAGTTCCCAAATTGG - Intergenic
930183815 2:48390907-48390929 TGATGAAAATGTTCTGGAAATGG - Intergenic
930532321 2:52605149-52605171 TGATTAAAATGTTCTAAAATTGG - Intergenic
930587492 2:53285085-53285107 TAATGATTATGTTCTCAAATAGG + Intergenic
930792798 2:55352122-55352144 TGATGAAAATGTCATGAAATTGG + Intronic
930857513 2:56034692-56034714 TTTTGAGAATGTTCTATAAATGG - Intergenic
931164945 2:59736337-59736359 AGATGATAATCTTTTAAAATCGG + Intergenic
931312719 2:61097466-61097488 TGATGGAAATGTGCTAAAATTGG - Intronic
931338620 2:61376099-61376121 TGATGGAAATGTTCTAGAATTGG + Intronic
931448348 2:62346142-62346164 TAATGAAAATGTTCTACAATTGG - Intergenic
931485996 2:62692511-62692533 TGATGAGGATGCAATAAAATTGG - Intronic
932069482 2:68603966-68603988 TGATGAGGATGTGGAAAAATTGG + Intronic
932602288 2:73136257-73136279 TGATGAAAATATTCTAAATCTGG - Intronic
932638718 2:73419002-73419024 TGATGAGAATGTCATTAAATAGG + Intronic
932645108 2:73492136-73492158 TAATGGCAATGTGCTAAAATTGG - Intronic
932737652 2:74265511-74265533 TGATGGAAATGTTCTAAAATTGG + Intronic
932976643 2:76609614-76609636 TGCTGAGAATTTTCCTAAATTGG - Intergenic
933156168 2:78978149-78978171 TGTTGAGAATCTTTTAGAATGGG - Intergenic
933579866 2:84113333-84113355 TGATGACAATGTTCTAAAACTGG - Intergenic
933867147 2:86530802-86530824 TGGTGAGTATGTGGTAAAATTGG - Intronic
934497178 2:94814808-94814830 TGATGGAAATGCTCTAAAGTTGG - Intergenic
934740813 2:96721063-96721085 TGATGAAAATGTTTTAAAATTGG - Intronic
935086824 2:99855215-99855237 TGATGGAAATGTTTGAAAATTGG + Intronic
935343466 2:102081107-102081129 TGATGAAAATGCTCTGAAATTGG + Intronic
935527965 2:104195786-104195808 TAATAAATATGTTCTAAAATTGG + Intergenic
935782681 2:106521762-106521784 TGATGGGAATGATCAGAAATGGG + Intergenic
935930361 2:108117683-108117705 CGATGAAAATGTTCTAAAATTGG + Intergenic
936393911 2:112103704-112103726 TGATGAAAATTTTCCAAAATTGG + Intronic
936442458 2:112566672-112566694 TGATGAGAAAGTTCTGAAGATGG - Intronic
936919568 2:117673953-117673975 GGATGAAAATGTTCTAAAATAGG + Intergenic
937073227 2:119081615-119081637 TGGTGAGAATGTGGAAAAATTGG - Intergenic
937187646 2:120060119-120060141 TGGTGAGAATGTGCAGAAATGGG + Intronic
938249551 2:129803836-129803858 TGATGAAAATGTTTTAAAATCGG + Intergenic
938375877 2:130806289-130806311 AGATTAAAATATTCTAAAATTGG + Intergenic
938396873 2:130957514-130957536 TGTTGAGAATGTTCTAAAATTGG + Intronic
939076008 2:137603384-137603406 TAATTAAAATGTGCTAAAATGGG + Intronic
939277488 2:140017905-140017927 TGATGAAAATCTTATAAAACTGG + Intergenic
939282456 2:140081792-140081814 TGATCTGATTGTCCTAAAATTGG - Intergenic
939377647 2:141390305-141390327 TGATGAGAATGTAGAGAAATTGG + Intronic
939585122 2:143994783-143994805 TGATGGAAATGTTCTAAAACTGG + Intronic
940319632 2:152363087-152363109 CGATGAAAATGTTCTAAAATTGG + Intronic
940413582 2:153394583-153394605 TGATGAGAATATTCCAAGAAAGG - Intergenic
940828989 2:158446715-158446737 TGATGTTAATGTCCTAAAAGTGG - Intronic
940969648 2:159881967-159881989 TGATGGAACTGTTCTACAATTGG - Intronic
941507430 2:166364727-166364749 TGATGAAAATGTTCTGAAGATGG + Intronic
941785241 2:169490750-169490772 TGATGAAAATATTCTGGAATTGG - Intronic
942031914 2:171971356-171971378 TGATGGAAATGTTCTAAAACAGG - Intronic
942285850 2:174415224-174415246 TGATAAGCATGTTAGAAAATGGG - Intronic
942532462 2:176926407-176926429 TGGTGAAAATGTTCTAAAATTGG - Intergenic
942896095 2:181056295-181056317 TGTAGAGAAAGTTCTAGAATTGG + Intronic
943058343 2:183011387-183011409 TGATGGAAATGTTCTAAAGCTGG - Intronic
943151384 2:184118007-184118029 TAATAAGCATGTTTTAAAATGGG - Intergenic
943343847 2:186713581-186713603 TTATTAGAAAGTTATAAAATGGG - Intronic
943640856 2:190356344-190356366 TTATGAGAAATTCCTAAAATCGG + Intronic
943761418 2:191613537-191613559 TGATGATAAATTTCTAAAAGGGG + Intergenic
944005992 2:194906548-194906570 TAAAGAGAAAGTGCTAAAATAGG - Intergenic
944144440 2:196491000-196491022 TGATGAAAATGCTCTAAAACTGG + Intronic
944480363 2:200151709-200151731 TGATGAAAATGTTCCAAAACTGG + Intergenic
944548157 2:200819052-200819074 TGATGATAATGCTCTGAATTGGG + Intronic
944660557 2:201918080-201918102 TGATGACTATGTTCTAAGATTGG - Intergenic
944739871 2:202601486-202601508 TGAGGAGAAAATTTTAAAATGGG + Intergenic
944826432 2:203488016-203488038 TGTTGACAATATTCTAATATGGG - Intronic
944926096 2:204466372-204466394 TAATGAGAAGGTTTTAAAACAGG + Intergenic
945223303 2:207506288-207506310 TGATAAAAAAGTTCAAAAATGGG - Intergenic
945433950 2:209796916-209796938 TGATGAAAATGTTCTTAAATTGG - Intronic
945687477 2:212989255-212989277 TGGTCTGAATTTTCTAAAATAGG - Intergenic
945764208 2:213954077-213954099 TGATAAGATTGTTCTAACATTGG - Intronic
945880601 2:215321077-215321099 TGATGAATATGTTTTAATATTGG - Intronic
946119784 2:217499997-217500019 TGATGAAAATGTTCTGGAATTGG + Intronic
946734131 2:222737579-222737601 TGATGAAAACGTTCTGGAATTGG - Intergenic
947087648 2:226473969-226473991 TGATAAAAATATTCTAAAATTGG + Intergenic
947122187 2:226828064-226828086 TGATGGAAATGTGCTAAAACTGG - Intergenic
947352326 2:229259016-229259038 TGATGAGAATGTGGAAAAACAGG - Intronic
947452347 2:230220316-230220338 TGATGAAAATGTTCTCAAACTGG + Intronic
947519554 2:230833935-230833957 TGATTAAAATGTTCTAACACTGG + Intergenic
947848260 2:233263085-233263107 TGAAGAGAATGTGCAAAAAACGG - Intronic
948702308 2:239768060-239768082 TGATGAAAAGGTTCTAAAACTGG - Intronic
948736668 2:240012543-240012565 TGATGAAAACATTCTAAAACTGG + Intronic
1169107909 20:3013021-3013043 GGATGACAATGTTCTAAAATTGG - Intronic
1169185629 20:3614739-3614761 TGGTGAAAATATTCTAAAATTGG - Intronic
1169233893 20:3913097-3913119 TGATAAAAATGTCCTAAAATTGG - Intronic
1169309838 20:4526428-4526450 TGATGAGAATGTGGAGAAATTGG + Intergenic
1169328626 20:4698447-4698469 TCACAAAAATGTTCTAAAATTGG + Intronic
1169566982 20:6865422-6865444 TGATGGAAATGATCTAAATTTGG + Intergenic
1170224344 20:13974999-13975021 TGAAGAGAATATTCTGAGATTGG - Intronic
1170796031 20:19547427-19547449 TGATGGAAGTGTTCTAAAACTGG + Intronic
1171102679 20:22400351-22400373 TGATTAAAATGTTCTAAAATTGG - Intergenic
1171416852 20:24987657-24987679 TGACAAGAATGTTCTAAACTTGG + Intronic
1171540349 20:25946473-25946495 TGATGACAATGTAATAAAACTGG + Intergenic
1171725004 20:28608800-28608822 TGAAGTGAATGTTCTAAAACTGG - Intergenic
1171753071 20:29074252-29074274 TAAAGTGAATGTTCTAAAACTGG + Intergenic
1171789192 20:29503314-29503336 TAAAGTGAATGTTCTAAAACTGG - Intergenic
1171800724 20:29613849-29613871 TGATGACAATGTAATAAAACTGG - Intergenic
1171843378 20:30242845-30242867 TGATGACAATGTAATAAAACTGG + Intergenic
1172378168 20:34463576-34463598 TGATGAGAACGTACAGAAATTGG - Intronic
1172736975 20:37134105-37134127 TGATGGAAATGTTCTAAAATTGG - Intronic
1172747058 20:37219153-37219175 TGGTGAGGATGTAGTAAAATTGG - Intronic
1173359153 20:42324415-42324437 TGATGAAAATATTCTAAAATGGG + Intronic
1173431529 20:42991612-42991634 TGATGAAAAAGTTCTAGAAATGG + Intronic
1173438291 20:43052731-43052753 TGATGAAAATGCTCTATAATTGG - Intronic
1173691381 20:44963894-44963916 TGATGAAAATGTTCTAAAATTGG - Intergenic
1174477318 20:50805190-50805212 TCATAAAAATGTTCTAAAATTGG - Intronic
1175060964 20:56242599-56242621 TGATGAAAATGTTAGAAAACTGG - Intergenic
1175435322 20:58943237-58943259 TGATAAGAATGTTCTGGAACTGG + Intergenic
1175695963 20:61102802-61102824 TGATGAAAATGCTCTAATATTGG - Intergenic
1175745651 20:61455054-61455076 TGATGAAAATGTGCTTGAATTGG - Intronic
1176852495 21:13933562-13933584 TGATGGAAATGCTCTAAAGTTGG - Intergenic
1176975761 21:15319730-15319752 TGATGAAAATGTACTTACATGGG - Intergenic
1177057959 21:16333127-16333149 TGATGAAAAAGTTCTATAGTTGG + Intergenic
1177172858 21:17672848-17672870 AGAGGAGATGGTTCTAAAATAGG + Intergenic
1177826515 21:26090224-26090246 TAATGCAGATGTTCTAAAATCGG - Intronic
1178064633 21:28890595-28890617 TGAAGAGAATGTGCAACAATAGG + Intergenic
1178162305 21:29933227-29933249 TTAAGAAAATGTTCTGAAATTGG + Intronic
1178235225 21:30834033-30834055 TAAAGAAAATGTTCTGAAATTGG - Intergenic
1178381982 21:32117809-32117831 TAATGAGGACATTCTAAAATTGG - Intergenic
1178477239 21:32947661-32947683 TGATGAAAATATTCTCAACTTGG - Intergenic
1178541878 21:33458635-33458657 TGATAAAAATATTCTCAAATTGG + Intronic
1179877595 21:44278384-44278406 TGGTGAGAATGTAGAAAAATTGG - Intergenic
1180409863 22:12596319-12596341 TAAAGTGAATGTTCTAAAACTGG + Intergenic
1180939191 22:19645764-19645786 TGATAGAAATGTTCTAAAACTGG - Intergenic
1181361651 22:22342502-22342524 TGATGAGAATGAGTTAGAATAGG - Intergenic
1181552876 22:23650887-23650909 TGATGAAAATGTTCTAAAATTGG - Intergenic
1181740300 22:24916153-24916175 TAATGAAAATGTTCTGAAATTGG - Intronic
1181899645 22:26142897-26142919 TGATAAGAATGTGCTAAAACTGG + Intergenic
1182113198 22:27738922-27738944 TGATGAGAATGTTCTGGAATTGG + Intergenic
1182159688 22:28108960-28108982 TGATGAGATTGTCCTAAAATTGG + Intronic
1182402397 22:30089821-30089843 TGATGAGAAGGTTTTAGAAATGG - Intronic
1183794363 22:40103315-40103337 TGACGGAAATGTTCTAAAACTGG - Intronic
1183799263 22:40147930-40147952 TGATGAAAAAGTTCTAAGATTGG + Intronic
1183849548 22:40573162-40573184 TGATGAAAATGTTCTGGAATTGG + Intronic
1184633513 22:45805747-45805769 TGAGGAAAATGTTGGAAAATTGG + Intronic
1185099678 22:48831418-48831440 TGCTAGAAATGTTCTAAAATTGG + Intronic
949168471 3:969407-969429 TCATGACAATGTTATACAATTGG + Intergenic
949271429 3:2222458-2222480 AGATGAAAATGTTCTGAAATTGG + Intronic
949291667 3:2473590-2473612 TGATAGGTATGTTCTAAAATTGG - Intronic
949409513 3:3748615-3748637 TATTGAGAATGTGCTAAACTTGG - Intronic
949445954 3:4133752-4133774 TGATCAGAAGGTCCTACAATAGG - Intronic
949446498 3:4140251-4140273 TGATGTGAATGTAATAAAATAGG + Intronic
949900082 3:8806250-8806272 TGATGAGAATGTTCTAAAACTGG + Intronic
949948572 3:9210197-9210219 TGATGGAGATGTTCTAAAATTGG + Intronic
950300710 3:11875523-11875545 TGATCAGAAAGTTCTAGAAATGG - Intergenic
950303762 3:11902978-11903000 TGATGAAAATGTTCTGAAATTGG - Intergenic
950366666 3:12490697-12490719 TGATGGGAATGTTCTAAAACTGG - Intronic
950827416 3:15839149-15839171 TGATGAAAATACTCTAAAACTGG + Intronic
951712230 3:25594934-25594956 TCAAGAGAATGTACTAAAACAGG + Intronic
952006027 3:28843219-28843241 TGATGGAAATGTTTTAAAATTGG + Intergenic
952228979 3:31409463-31409485 TGATGGAAATGTTCTAAAACTGG - Intergenic
952291324 3:32019105-32019127 TGATGTTGATGTTCTAAAACTGG - Intronic
952320543 3:32273736-32273758 TGATAAAAATGTTCTGAAATCGG + Intronic
952449383 3:33417227-33417249 TGATGCGAGTGTTCTAAAACTGG - Intronic
952458929 3:33503817-33503839 TGATGAGGATGTACAAAAATTGG - Intronic
952489777 3:33857144-33857166 TAATTAGAATGTTTTAAAAATGG + Intronic
952499518 3:33947238-33947260 TGATGAAAAAGTTCTAGAAATGG - Intergenic
952511082 3:34056705-34056727 GGCTGAAAATGTTCTAAAATTGG - Intergenic
952749654 3:36815022-36815044 CAATGAGAATGTTCTAAACCTGG + Intergenic
952757259 3:36881693-36881715 TGATGAAAATGTTCTGGAATTGG - Intronic
952779943 3:37086712-37086734 TGATGAAAATGTTCTAAAGATGG + Intronic
952909296 3:38168292-38168314 TGATGGAAATATTCTAAAACTGG - Intronic
952909319 3:38168613-38168635 TGATGGAAATGTTCTAAAATTGG - Intronic
952927436 3:38330928-38330950 TGATGAATATGTTCTAAAATTGG + Intergenic
953146602 3:40281995-40282017 TGATAAGAATGTTCTCAAATTGG - Intergenic
953225907 3:41020378-41020400 TGATAAAAATGTTCTAAAATTGG + Intergenic
954069509 3:48132610-48132632 TAATGGGAATGTTCTAAAACTGG - Intergenic
954846426 3:53562626-53562648 TTATGAAAATGTTATAAAACTGG - Intronic
955440950 3:58955110-58955132 TGATGGGATTGTTCTACAGTTGG - Intronic
955640918 3:61083269-61083291 TGATTAGAATGTTCTAAAATTGG - Intronic
955749319 3:62171510-62171532 CGATGAAAATATTCTAAAACTGG - Intronic
956215210 3:66841788-66841810 TGATGGAAATGTTCTAATCTGGG - Intergenic
956574700 3:70739263-70739285 TGATGGAAATGTTCTAAAATTGG + Intergenic
956760837 3:72443038-72443060 TGATGGAAATGTTCTAAAACTGG + Intronic
956810951 3:72863590-72863612 AGATGGAAATGTTCTGAAATTGG - Intergenic
956932627 3:74062426-74062448 TAATGAAAATGTTCTCAAACTGG + Intergenic
957511423 3:81193119-81193141 TGATTAGAAAGTCCAAAAATAGG - Intergenic
957543880 3:81611724-81611746 GGATGAGAATTGTCTATAATTGG + Intronic
958473158 3:94548161-94548183 TGATGAGAATGTAAATAAATGGG + Intergenic
958975528 3:100663508-100663530 AGATGAGAAAGTTCTAGAGTAGG - Intronic
959090413 3:101896701-101896723 TGATGAAACTATTCTAAAATTGG - Intergenic
959114818 3:102164057-102164079 TGATGAAAATGTTCTATAGCTGG + Intronic
959511464 3:107217448-107217470 TGATAGAAATGTTCTCAAATTGG + Intergenic
959645332 3:108693134-108693156 TAAGGAGAATGTATTAAAATAGG + Intronic
959671382 3:108981280-108981302 AGATGAGGATCTTTTAAAATTGG + Intronic
959896009 3:111607033-111607055 TGATGAAAATGTTCTGAAATTGG - Intronic
960216298 3:115042295-115042317 TGAAAATAATGTTTTAAAATTGG - Intronic
960414967 3:117373443-117373465 TGAAGAGCATGATTTAAAATAGG - Intergenic
960775483 3:121246970-121246992 TAATGGAAATGTTCTAAAACTGG + Intronic
960843186 3:121981051-121981073 TGATAGAAATGTTCTAAAATTGG - Intergenic
960893965 3:122481575-122481597 TGACTAAAATGTTCTAAAATTGG + Intronic
961032207 3:123616041-123616063 TGATGAAAATGTTCTAAAATTGG + Intronic
961431174 3:126884466-126884488 TTTTGAAACTGTTCTAAAATTGG + Intronic
961707733 3:128801766-128801788 TGCTGAGAATTTTCGAGAATTGG + Intronic
961725872 3:128929815-128929837 TGATGGAAATGTTCTAAAACTGG + Intronic
962052988 3:131837987-131838009 TGATGAAAATACTCTAAAAATGG - Intronic
962759908 3:138501374-138501396 TAATGAATATGTTCTGAAATTGG - Intronic
962822013 3:139058176-139058198 TGATGGAAGTGTTCTAAAACTGG - Intronic
962966799 3:140363382-140363404 TAATAGAAATGTTCTAAAATTGG + Intronic
962979859 3:140478625-140478647 TAATGGAAATGTTCTAAAACTGG + Intronic
963226215 3:142864607-142864629 TGATGGAAATATTCTGAAATTGG - Intronic
963389311 3:144637758-144637780 TGATGTCAATGTTCTAAAGTAGG - Intergenic
963406794 3:144875341-144875363 TGATGAGAATGTGGGAAAAGAGG - Intergenic
963731469 3:148977749-148977771 TGATGAGGATGTGGAAAAATAGG - Intergenic
964283522 3:155092893-155092915 TAATGGAAGTGTTCTAAAATTGG + Intronic
965424688 3:168507381-168507403 TGTTGAGAATGTACAAAGATGGG + Intergenic
965534416 3:169810525-169810547 ACATGAAAATTTTCTAAAATAGG - Intronic
965712266 3:171567377-171567399 GGATAAAAATGTTCTAAAACTGG - Intergenic
965730362 3:171765100-171765122 TGATGAAAATGTTTAAAAAATGG + Intronic
966682231 3:182655012-182655034 TGATGAAAATGTTCTGGAATTGG + Intergenic
966708126 3:182939739-182939761 TGATGGACATGTTCTAAAATTGG + Exonic
966954943 3:184866441-184866463 TGATGATAATGTTCTCAAAATGG + Intronic
967015279 3:185476061-185476083 TGATAAAAGTGTTGTAAAATTGG - Intronic
967268327 3:187711907-187711929 TTTTGAGAATGTTCTATAAATGG - Intronic
967303066 3:188035886-188035908 TGCTGAAAATATTCTAGAATTGG + Intergenic
967587090 3:191228142-191228164 TAATCAGAATGTCCTCAAATTGG + Intronic
967641385 3:191868756-191868778 TGGTGAGAATGTGGAAAAATTGG + Intergenic
968351508 3:198058180-198058202 TGATGAAAATGTTCTAAAGCTGG - Intergenic
968467815 4:761659-761681 TGATGAGACTGTTTTAAAATAGG + Intronic
969225378 4:5794028-5794050 TGATAGAAATGTTCTAAATTTGG - Intronic
969290571 4:6236577-6236599 GGATGAAAATGTCCTAAAATTGG + Intergenic
969551999 4:7875978-7876000 TGATGAAAATGTTCTGGAAATGG + Intronic
970061900 4:12042843-12042865 TGAGGATAATTCTCTAAAATAGG + Intergenic
970379240 4:15490244-15490266 TGATAAAAATGTTCTAAAACTGG - Intronic
970413539 4:15834474-15834496 CTCTAAGAATGTTCTAAAATTGG - Intronic
970616253 4:17770925-17770947 TAATGAGAATGTTCTAAAGTTGG - Intronic
970923785 4:21426298-21426320 TGATGAAAATGTTCTAAAATTGG + Intronic
970932845 4:21533487-21533509 AGATGGAAATGGTCTAAAATGGG - Intronic
971153298 4:24056808-24056830 TGATGAGGATGTGGTGAAATTGG + Intergenic
971430372 4:26559254-26559276 TGGTGAGAATGTACAGAAATTGG - Intergenic
971636235 4:29062371-29062393 TGATGAGAATGTGAAGAAATTGG - Intergenic
972679168 4:41288934-41288956 TGATGGAAATGTTCTAAAACCGG - Intergenic
972688822 4:41376851-41376873 TGATGGAAATGTTCTGGAATTGG + Intronic
973215579 4:47665989-47666011 TTATGAGCATGTTATAAAAGAGG - Intronic
973845433 4:54908123-54908145 TGACAAAAATGCTCTAAAATTGG + Intergenic
973932198 4:55804335-55804357 TGATGAGAATGTTATGAAGGTGG - Intergenic
973955965 4:56063477-56063499 TGATGAAAAAGTTCTGAAAATGG - Intergenic
973992660 4:56426076-56426098 TGATCAAAATGTTCTAAAATGGG - Intronic
974026873 4:56740756-56740778 TGATGGGAATGTCACAAAATAGG + Intergenic
974432063 4:61811536-61811558 TGATGAAAATGTTCTAAAATTGG + Intronic
974506897 4:62786844-62786866 TTATGAGTTTGTTCTAAGATAGG + Intergenic
974579286 4:63774502-63774524 AGATGAAAATATTCTAAATTGGG + Intergenic
975172873 4:71252793-71252815 TGGTGGAAATGTTCTAAAATTGG + Intronic
975659063 4:76670472-76670494 TGATGAAAATGTCCTAAACCTGG + Intronic
975775155 4:77778729-77778751 TTATAAAAATGATCTAAAATTGG - Intronic
976021787 4:80638303-80638325 TGAAGAAAATGTTCTCAAATTGG - Intronic
976374611 4:84330334-84330356 TGATCAGAATGTTTTAAAGCTGG - Intergenic
976603024 4:86956541-86956563 AGATGAAAATGTTCTAAAGCTGG - Intronic
976724605 4:88203421-88203443 TAATTAGAATGTTCGAATATTGG + Intronic
976783423 4:88788136-88788158 AGATGAGAAAGTTGTTAAATTGG - Intronic
976806070 4:89048474-89048496 TGGTGGGAATGTTCTAGAAATGG + Intronic
976981695 4:91239761-91239783 AGGTTAGAAAGTTCTAAAATAGG - Intronic
976981787 4:91241013-91241035 AGGTTAGAAAGTTCTAAAATAGG - Intronic
977309340 4:95365604-95365626 TGAAAAGAATATTTTAAAATAGG - Intronic
977797258 4:101181165-101181187 TCATGAGAATTTTTTCAAATTGG + Intronic
978170237 4:105660930-105660952 CCACGACAATGTTCTAAAATTGG - Intronic
978278736 4:106984287-106984309 TGATGAAAAAGTTCTAGAAATGG - Intronic
978418249 4:108502089-108502111 TGATGAGAAGGTACTCAACTGGG + Intergenic
978868977 4:113551527-113551549 TGATGAAAATGTTCTATATCTGG + Intronic
978918676 4:114154869-114154891 TGCTCATAATGTTCTAAATTTGG + Intergenic
979078191 4:116301452-116301474 TCATGTGAATGTTCTGAACTGGG - Intergenic
979352304 4:119658419-119658441 TAATGAAAATGTTCTGAAATTGG - Intergenic
979358877 4:119738248-119738270 TGATGAGTAGGTGTTAAAATAGG + Intergenic
980064767 4:128173863-128173885 TGATGGAATTGTTCTAAAACCGG - Intronic
980126021 4:128775082-128775104 TGATGAAAATGTTCTAATTGTGG + Intergenic
981071736 4:140547685-140547707 TGATGAAAATGTTCTAAAAGTGG - Intronic
981216897 4:142180125-142180147 TGACAAAAATGTCCTAAAATGGG + Intronic
981358215 4:143816452-143816474 TGATGAGTATATTATAAAAAAGG - Intergenic
981369457 4:143942570-143942592 TGATGAGTATATTATAAAAAAGG - Intergenic
981399469 4:144296431-144296453 TGATGAAAGTGTCCTAAAACTGG - Intergenic
981557796 4:146014200-146014222 TGATGGAAATGTTCTAAAGCAGG - Intergenic
982029946 4:151290587-151290609 TGATAAAAATGTTCTAAAATGGG + Intronic
982177821 4:152722915-152722937 TGATGAGGATGTGGAAAAATTGG + Intronic
982236541 4:153256011-153256033 TGATGAAAATGTTCCAAAATTGG + Intronic
982649606 4:158070829-158070851 TGACAAAAAAGTTCTAAAATTGG + Intergenic
982856717 4:160392110-160392132 TTATGTGAATAGTCTAAAATAGG + Intergenic
983024927 4:162724875-162724897 TCATGAGAATGAAATAAAATAGG - Intergenic
983234901 4:165168180-165168202 TGATGAAAAAGTTCTGAAATTGG - Intronic
983323295 4:166223269-166223291 CGATTTGAATGATCTAAAATTGG + Intergenic
983794440 4:171842975-171842997 TGATGACAGTCTTGTAAAATTGG - Intronic
984190702 4:176602226-176602248 TGAAGAGAAATTTTTAAAATTGG - Intergenic
984328866 4:178290034-178290056 TGGTGAGAATGTGGAAAAATAGG + Intergenic
984386678 4:179068810-179068832 TGATGAAAATGTGCTGAAATTGG - Intergenic
984957687 4:185061981-185062003 AGATGGAAATGTTCTAAAACTGG + Intergenic
985047890 4:185958844-185958866 TGATTAGAAGATTTTAAAATGGG + Intergenic
985061829 4:186087918-186087940 TGATGAAAGTGCTCTATAATTGG + Exonic
985157623 4:187007455-187007477 TGATGAAAATGTTCTGGAACTGG - Intergenic
985295302 4:188431468-188431490 AGATGGAAATGTTCTAAAACTGG + Intergenic
985436479 4:189934904-189934926 TGAAGTGAATGTTCTAAAACTGG + Intergenic
987205403 5:15620068-15620090 AGATGACAATGTTCTGAAATTGG + Intronic
987523628 5:19019984-19020006 TAATGAAAATGTCGTAAAATTGG - Intergenic
987812945 5:22862423-22862445 TGAAGTGAATGTTTTAAAATTGG - Intergenic
987882982 5:23774019-23774041 CGATGAGAATGCACTTAAATGGG - Intergenic
988101046 5:26679317-26679339 TAATAAGAATGTTATAAAGTAGG + Intergenic
988111281 5:26824349-26824371 TGCTGAGAATTTTCTTATATAGG - Intergenic
988138756 5:27208606-27208628 AAATGAGAATATTCTAAAGTAGG + Intergenic
988722772 5:33894495-33894517 TGTTGAGAACGTGCTAAAGTTGG - Intergenic
988855722 5:35226568-35226590 TCAAGAGAAAGTTCTTAAATTGG - Intronic
988979708 5:36554531-36554553 TGATGAAAATTTTCTAAAATTGG - Intergenic
989287798 5:39722311-39722333 TCAAGAGAATGTTATATAATTGG + Intergenic
990687977 5:58329343-58329365 TGATAAAAATCATCTAAAATGGG + Intergenic
991055948 5:62320869-62320891 TCATAAAAATGTTCTGAAATTGG - Intronic
991154152 5:63410680-63410702 TGATGAAAATGTTCTGGAATTGG - Intergenic
991246170 5:64510586-64510608 TGATGGAAATGTTCCAGAATTGG + Intronic
991605695 5:68398363-68398385 TGATGAAAATTACCTAAAATTGG + Intergenic
992124991 5:73630773-73630795 TGAGTAGAATGTTAAAAAATGGG - Intronic
992247548 5:74842056-74842078 TAATGAAAATGTTCTACAATTGG + Intronic
992526398 5:77615095-77615117 TGAAGGTAATGTTCTAAAACTGG + Intronic
992661454 5:78965520-78965542 TGATAAAAATGTTCTACAATTGG + Intronic
992782879 5:80143949-80143971 TGATGAGAATGTTTGGAAATGGG - Intronic
993140103 5:84021650-84021672 TGATGAGAACGTTGTATATTTGG + Intronic
993599211 5:89900014-89900036 TGATGAAAACGTTTTAAATTTGG - Intergenic
994445499 5:99867839-99867861 TGATGAGAATGTGGAGAAATTGG - Intergenic
994816565 5:104593842-104593864 TGAAGACAATGTTCTAAAGAGGG - Intergenic
995303636 5:110616812-110616834 TGATGAGGATGTTCAGAAAAGGG + Intronic
995500352 5:112798452-112798474 TGATGAAAATGTTCTAAAACTGG + Intronic
995570606 5:113476797-113476819 TGATGAAACTATTCTAAAATTGG + Intronic
995654915 5:114414911-114414933 TGATGGAACTGTTCTAAAACTGG - Intronic
995734554 5:115286140-115286162 TGATGAAAATATTCTGAAACTGG - Intronic
995798575 5:115966285-115966307 TTTTGAGAATGTTCTATAAATGG + Intronic
995886199 5:116896814-116896836 TGCTGATAATGTATTAAAATTGG - Intergenic
995977034 5:118051176-118051198 TGATGGAAATATTCTAAATTTGG + Intergenic
996640790 5:125750595-125750617 TGGTGGAAATATTCTAAAATGGG + Intergenic
996695630 5:126391800-126391822 TGATGAAAATGTTCTAGAATTGG + Intronic
996699015 5:126430455-126430477 GGATGAAAATGTTCTTAAACTGG - Intronic
996878319 5:128264082-128264104 TGATGAGAATGTTCGGAAACTGG + Intronic
996894804 5:128468057-128468079 TGATGAAAATGTTCTAAAACTGG - Intronic
996975641 5:129430210-129430232 TGATAAAAATGTTCTAAGGTTGG + Intergenic
997063760 5:130538672-130538694 CGATGAAAATGTACTAAAATTGG + Intergenic
997183083 5:131852702-131852724 TGATGAAAATGTTCTTAAATAGG + Intronic
997898858 5:137744829-137744851 TGTTGAGAAAGTTCTGAAAATGG - Intergenic
997947710 5:138217059-138217081 TGATGAAAATGTTCTCGAATAGG - Intergenic
998076973 5:139244784-139244806 TGATGAAAATATTCTAGGATTGG + Intronic
998346857 5:141471927-141471949 TGATGAGAGTTTTCTAAAACTGG + Intronic
998436924 5:142118155-142118177 TGATAACAATGTACTAATATTGG - Intronic
998518297 5:142776340-142776362 TGCTAAAAATGTTCTAAAACAGG - Intronic
998861144 5:146445604-146445626 TGATAAAAATGTTCTGGAATTGG - Intergenic
998943856 5:147315622-147315644 TGATGAAAATGTTCTAAAAATGG + Intronic
999203356 5:149831998-149832020 TGATGGATATGTTCTAAAACTGG - Intronic
999540004 5:152560991-152561013 TGAGGAAAAGGTTGTAAAATAGG - Intergenic
999817370 5:155190999-155191021 TGATGAAAATGTTCTCAAACTGG - Intergenic
1000044473 5:157510511-157510533 TGATGAAAATATTCTAACACTGG - Intronic
1000073860 5:157766339-157766361 TGATGAGAAAGCTATAAAAGTGG - Intergenic
1000448694 5:161357581-161357603 TGTTGGGAATGTTCTACATTGGG + Intronic
1000496932 5:161995753-161995775 TGATTAGAATATTCTACAAAAGG - Intergenic
1000628003 5:163561705-163561727 TGACAGAAATGTTCTAAAATTGG + Intergenic
1000670587 5:164057773-164057795 TGATGAGAATGTAGAACAATAGG + Intergenic
1000807997 5:165821436-165821458 TGATGAGGATGTGAGAAAATTGG - Intergenic
1000844980 5:166268568-166268590 TGATGAAAATATTCTAAAATTGG + Intergenic
1000974063 5:167745617-167745639 TGATGAAAATATTCTAAAAGTGG - Intronic
1001070010 5:168577638-168577660 TTATGAGAAGTTTATAAAATAGG - Intronic
1002123685 5:177025058-177025080 TGACGGAAATGTTCTAAAAGTGG - Intronic
1002144762 5:177170955-177170977 TGACAAAAATGTGCTAAAATTGG - Intronic
1002326391 5:178411157-178411179 TGATGAGGATGTGGAAAAATTGG + Intronic
1002330922 5:178440060-178440082 TGATGGAGATGTTCTAAAACTGG + Intronic
1002464874 5:179402826-179402848 TTATGAGAATGTTGTACAAATGG - Intergenic
1003161058 6:3634748-3634770 TGATGAAAATGTTTTAAAGCTGG + Intergenic
1003602627 6:7531521-7531543 TGATGAAAAAGTTCTAGAAATGG + Intergenic
1003691460 6:8358358-8358380 TGATGTAAATGTTCTGAAACTGG - Intergenic
1004042069 6:11989445-11989467 TGATGGAAATGTTTTAAAATTGG - Intergenic
1004242824 6:13942640-13942662 TGCTGAGAATATTCTAAAACTGG - Intronic
1004500375 6:16204570-16204592 TTATAAAAATGTTTTAAAATTGG + Intergenic
1004563569 6:16774416-16774438 TGATCAAAATCTTCTAGAATTGG - Intergenic
1004568813 6:16825121-16825143 GGATGAGAATATTCTGAAGTTGG - Intergenic
1004699291 6:18064124-18064146 AGATGGAAATGTTCTAAAGTTGG - Intergenic
1005483411 6:26276197-26276219 TGATAAGTATGTTCTTTAATTGG + Intergenic
1005582012 6:27244397-27244419 TACTGAAAATGTTCTAAAACTGG + Intergenic
1005876730 6:30016300-30016322 TGATGAAAATGTTCTGGAAATGG + Intergenic
1005888713 6:30118528-30118550 TGATGAGGATGTGGAAAAATGGG + Intergenic
1006556307 6:34870053-34870075 TCATGGAAATGTTCTAAAATTGG - Intronic
1006633267 6:35444475-35444497 TGATAAAAATGTTCTAAAATTGG - Intergenic
1006969419 6:38025935-38025957 TGATGAAAACAATCTAAAATTGG + Intronic
1007043087 6:38743482-38743504 TGATGAAAATGTTCCAAAATTGG - Intronic
1007802943 6:44413081-44413103 TGATGAAATTATTCTAAAATTGG - Intronic
1008038588 6:46773566-46773588 TGTTGAAAATCTTCTAAAATTGG - Intergenic
1008584358 6:52935386-52935408 TGAGGAGACTGTTCCAAAACTGG + Intergenic
1008672715 6:53789151-53789173 GGCTGAAAATGTTCTAAATTTGG + Intergenic
1009461029 6:63913432-63913454 TGACAAAAATGTTCTGAAATTGG - Intronic
1009645090 6:66391400-66391422 TCATGAGAATTTTGTGAAATTGG - Intergenic
1009896777 6:69761736-69761758 TAATGGAAATGTTCTAAAACTGG - Intronic
1009975449 6:70666888-70666910 TTATGAGGAAGTTCTAATATGGG - Intergenic
1010076626 6:71805621-71805643 TGCTGAGAAGGTACAAAAATGGG - Intergenic
1010103399 6:72138340-72138362 AGATTAAAATGTTCTAAAACTGG - Intronic
1010424044 6:75706252-75706274 TGATGAAAAGGTTTAAAAATTGG + Intronic
1010787764 6:80024648-80024670 AGACGAAAATATTCTAAAATTGG + Intronic
1010801639 6:80183584-80183606 TGATGACAATGTGTTAACATAGG - Intronic
1011014513 6:82740174-82740196 TTATTAGAATGTTCTAATATTGG + Intergenic
1011111842 6:83846975-83846997 TGATGGAAATCTTCTAAAATTGG - Intergenic
1011567968 6:88699966-88699988 TGATGAGAAAGTTCTGGAAATGG + Intronic
1011676596 6:89740921-89740943 TGATGGAAATGTTGTAAAACTGG + Intronic
1011972236 6:93240615-93240637 TGAGGACAGTGTTCTAAAAAAGG + Exonic
1012230812 6:96759245-96759267 TAATAAGAAAGTTCTAAAATGGG + Intergenic
1012634012 6:101512639-101512661 TGAAGAGAATGTCGTAAAAGTGG - Intronic
1012863289 6:104587993-104588015 TACTGAGAATCTTCTAATATTGG + Intergenic
1012926492 6:105273360-105273382 TGACAAAAATGTTCTAAAACTGG - Intergenic
1013439021 6:110142560-110142582 TGTTGGGATTGCTCTAAAATGGG - Intronic
1013518697 6:110913118-110913140 TTTTTAAAATGTTCTAAAATTGG + Intergenic
1013623247 6:111910847-111910869 TCATGAAAATGTCCTATAATTGG + Intergenic
1014946020 6:127498963-127498985 TGATGGAAATGTCCTAAATTTGG + Intronic
1014970109 6:127803291-127803313 TGATGAAAAGGTTCTAAAACTGG - Intronic
1015168657 6:130227058-130227080 TGATGAAAATGTTCTGGAAATGG - Intronic
1015314466 6:131802974-131802996 TGATGAAATTGTTCCAAAACTGG + Intergenic
1015495400 6:133876842-133876864 TAATGGAAATGGTCTAAAATTGG + Intergenic
1015614595 6:135062010-135062032 TGATGGAAATGGTCTAAGATTGG + Intronic
1015992570 6:138961993-138962015 TGAAGAGATTTTTCTAAAGTTGG + Intronic
1016273621 6:142321842-142321864 GGATGAGACTGTTCTAATAGAGG - Intronic
1016380926 6:143478292-143478314 TGATGAAAATGTTCTAAAATTGG + Intronic
1016426951 6:143945143-143945165 GGATGAGAATGTTCTAGATCAGG - Intronic
1016678541 6:146800409-146800431 TGATGAAAATGTTTTAAAACTGG + Intronic
1017258249 6:152358994-152359016 TGATGAGAGTTTTCTAAGGTGGG - Intronic
1017301016 6:152857889-152857911 TGATGGAAATGTTTAAAAATGGG + Intergenic
1017362353 6:153589443-153589465 TAATGAGAAGGTTCCAAAATCGG + Intergenic
1017648450 6:156560155-156560177 TGATGAGAAAGTTCTGGAAATGG + Intergenic
1018168030 6:161118157-161118179 TTATGGGAATGTTCTACAATTGG - Intergenic
1019367487 7:642299-642321 TGATGGAAACGCTCTAAAATTGG + Intronic
1019416824 7:931610-931632 TGATGAAAATGTCCTAATATTGG + Intronic
1019471125 7:1221616-1221638 TGATGAAAATGTTCCAGAACTGG + Intergenic
1020115566 7:5474228-5474250 AGATGAGAAAGTTCTAGAAGCGG + Intronic
1020424031 7:8043617-8043639 TGATGAAAAAGTCCTAAAATTGG + Intronic
1020507325 7:9008277-9008299 TGATGATAATGTTCTAATACTGG - Intergenic
1020653785 7:10906394-10906416 TGATTAAAATGTTCTAAAGTTGG + Intergenic
1020881771 7:13770447-13770469 TGTGGTGACTGTTCTAAAATTGG - Intergenic
1020943694 7:14573031-14573053 TAATAAAAATGTTCTAAAATTGG + Intronic
1020995002 7:15252282-15252304 TGATGGGAAAATTCTAAGATCGG + Intronic
1021034506 7:15781301-15781323 TGATTAAAATGTTCAAAAATAGG - Intergenic
1021177891 7:17471394-17471416 TGGTGAGAATGTGGAAAAATTGG + Intergenic
1021449216 7:20766584-20766606 TAATGACATTGTTTTAAAATTGG + Intronic
1021476334 7:21065748-21065770 TCATTAGAATGTCCTATAATAGG + Intergenic
1021928777 7:25558936-25558958 TGATGAGAACTGTCTAGAATAGG + Intergenic
1022071474 7:26919732-26919754 CTCTGAAAATGTTCTAAAATTGG - Intronic
1022463458 7:30634255-30634277 TGATGAAAATGTTCTAAAATTGG - Intergenic
1022726876 7:32989274-32989296 TGACAAAAATGTTCTAAAACAGG - Intronic
1022886176 7:34646674-34646696 TGAGAGAAATGTTCTAAAATTGG + Intergenic
1023041532 7:36177070-36177092 TGATTGAAATGTTCTAAAATTGG + Intronic
1023325086 7:39045661-39045683 TGAAGACAGTGTTCTAAAACTGG - Intronic
1023739172 7:43262931-43262953 TGATGTGACTGTTCATAAATGGG - Intronic
1024087385 7:45906266-45906288 TGATGAAAATGTTCCACACTTGG + Intergenic
1024685511 7:51740560-51740582 TTTTGAGAATGTTCTAAAACCGG + Intergenic
1025046709 7:55698360-55698382 TGACAAAAATGTTCTAAAACAGG + Intergenic
1025237718 7:57245794-57245816 TGATGAAGATGTTCTAAAACCGG + Intergenic
1025291783 7:57732716-57732738 TGATGACAATGTAATAAAACTGG + Intergenic
1025942598 7:66085083-66085105 TGATGAAAATGTTCTAAAATTGG + Intronic
1026028115 7:66763597-66763619 TGATGAAAATGTTCTAAAGTTGG - Intronic
1026047544 7:66917609-66917631 TGATGAAAATATTCAAAAACAGG - Intergenic
1026559123 7:71433415-71433437 TGATGAAAATGTTCCAAAATTGG + Intronic
1026674745 7:72419271-72419293 TGATGAAAATGGTCTAAAATGGG - Intronic
1026782448 7:73278086-73278108 TAATGAAACTGTTCTGAAATTGG - Intergenic
1026812082 7:73476207-73476229 TGATAAAAATGTTACAAAATTGG + Intronic
1027023210 7:74830907-74830929 TAATGAAACTGTTCTGAAATTGG - Intronic
1027064720 7:75114389-75114411 TAATGAAACTGTTCTGAAATTGG + Intronic
1027142496 7:75668896-75668918 TGATGAAAATGTCCTGGAATTGG - Intronic
1027262623 7:76476105-76476127 TCATTAGAATGTTCCATAATTGG + Intronic
1027314000 7:76974204-76974226 TCATTAGAATGTTCCATAATTGG + Intergenic
1027689521 7:81325537-81325559 TGTTGAGAATGTAGTGAAATTGG - Intergenic
1027712114 7:81617411-81617433 TAATGAAAATTTTTTAAAATTGG - Intergenic
1028245600 7:88473108-88473130 TGATGATAAATTTCTAAATTTGG + Intergenic
1028344806 7:89766357-89766379 TGGTGAGGATGTTGTGAAATTGG + Intergenic
1028474217 7:91235910-91235932 TGATGGAAATGTGTTAAAATCGG - Intergenic
1029003097 7:97176820-97176842 TTATGAAAATTTTCAAAAATGGG + Intronic
1029210231 7:98901950-98901972 TGATGACGTTATTCTAAAATTGG - Intronic
1029338871 7:99926715-99926737 TGATGAAAATGTTATTAAATTGG + Intronic
1029897692 7:104002829-104002851 TAATTAAAATGCTCTAAAATTGG - Intergenic
1029930845 7:104369154-104369176 TGATGGTAATGTCCTAAAACTGG - Intronic
1030318682 7:108142109-108142131 TGATGGAAATGTTCTAAAACTGG - Intergenic
1030593869 7:111512411-111512433 TGATGAAAATATTTTAAAACCGG + Intronic
1030676146 7:112387901-112387923 TGCTGAGAATGTGGAAAAATTGG + Intergenic
1030693435 7:112558332-112558354 TGATAAGAAAGTACTAAAGTTGG - Intergenic
1031102256 7:117495965-117495987 TGATGAAAGTGTTCTAAAATTGG - Intronic
1031121525 7:117727856-117727878 GGATGAGAATTTTCTAATAGAGG + Intronic
1031469746 7:122155036-122155058 TGATGAAAATGTTCTAAAATTGG + Intergenic
1031595355 7:123643700-123643722 TCATGGAAATGTTCTAAAATTGG + Intergenic
1031659752 7:124407740-124407762 TGAGGGGAATGTTTTAAATTTGG + Intergenic
1031851117 7:126865511-126865533 TAATAAAAACGTTCTAAAATTGG - Intronic
1032278338 7:130480350-130480372 TGATGAAAATATTCTAAAATTGG - Intergenic
1033297079 7:140149450-140149472 TTATTAGAATGTTCTAAAGAAGG + Intronic
1033786512 7:144737705-144737727 TGATGAAAATATTCTAAAATTGG - Intronic
1034402435 7:150872364-150872386 TAATGAAAACATTCTAAAATTGG + Intergenic
1034443536 7:151100248-151100270 TGATGAGAATCTAGTAACATGGG - Intronic
1035176138 7:157052536-157052558 TGATAAAAAAGTTCTAAAATTGG + Intergenic
1035202264 7:157275267-157275289 TGACGAGAATGTTCTGGAATTGG + Intergenic
1035436695 7:158864877-158864899 TGATGAGTGTTTTCTAAAAGAGG + Intronic
1035932773 8:3801983-3802005 TGATGAAAATATTCTAAAATCGG + Intronic
1036112779 8:5922448-5922470 TAATAAAAATTTTCTAAAATTGG + Intergenic
1036197043 8:6727762-6727784 TGAGTAGAATGTTATAAAAAGGG + Intronic
1036288488 8:7465649-7465671 TTATTAGAATATTCTATAATGGG - Intergenic
1036332987 8:7845879-7845901 TTATTAGAATATTCTATAATGGG + Intergenic
1036417096 8:8560930-8560952 TGATGAAAATGTCCTGGAATTGG + Intergenic
1036582211 8:10085692-10085714 TGATGACAGTGTTCTAAAACTGG - Intronic
1036921831 8:12863652-12863674 TGATGAAAAAGTTCTAGAAATGG - Intergenic
1037239753 8:16763315-16763337 TGATGGAGATGTTTTAAAATTGG - Intergenic
1037874790 8:22537413-22537435 TGATGAGAATGTGGAGAAATTGG + Intronic
1038015840 8:23514000-23514022 AGATGAAAATGTTCTAAAGATGG - Intergenic
1038192581 8:25337305-25337327 TGATGAGATTGGGCAAAAATTGG + Intronic
1038321652 8:26532470-26532492 TGATGCAAATGTTCTGAAAGTGG - Intronic
1038430918 8:27498776-27498798 AGGTGGAAATGTTCTAAAATTGG + Intronic
1038789211 8:30653098-30653120 TGATGGAAATGTTCTAAAATTGG + Intronic
1038861002 8:31388803-31388825 TTATGAGAACTCTCTAAAATGGG - Intergenic
1040100471 8:43497010-43497032 TCATGAAAATATTCTAAAATTGG - Intergenic
1040392765 8:46963675-46963697 TGGTGAAAATGGTCTAAAGTTGG + Intergenic
1040777638 8:51065727-51065749 TGATGAGAATGTGGTGAAAATGG + Intergenic
1040856341 8:51952539-51952561 AGATGGCAGTGTTCTAAAATTGG - Intergenic
1041141373 8:54823265-54823287 TGTTTAGAATGTTATATAATTGG + Intergenic
1041497992 8:58508107-58508129 TAATGAAAATGTTCTGGAATTGG - Intergenic
1041540529 8:58980001-58980023 TGATGAAAATGTTCTAAAAATGG + Intronic
1041967462 8:63696255-63696277 TGATGACAATGTTCCTAAATTGG + Intergenic
1042037406 8:64550504-64550526 TGATGAAAATGTCCTAAAACTGG - Intergenic
1042287458 8:67129892-67129914 TTATAAAAATGTTCTAAAACTGG + Intronic
1042809946 8:72813502-72813524 TAATGAGGAAGTTCTAAAAGGGG + Intronic
1043348507 8:79329604-79329626 TGATGATAAGGTTCTTAACTGGG - Intergenic
1043389945 8:79783062-79783084 GGACGAAAATGTTCTAAAATTGG + Intergenic
1043406904 8:79945539-79945561 TAATGAAAATGTTCTAAAACTGG + Intronic
1043468237 8:80535502-80535524 TGATGAGAGTGTTGGAAAGTTGG + Intergenic
1043589649 8:81814521-81814543 TGATGAAAATATTCTAAAATTGG + Intronic
1043604491 8:81983497-81983519 TGATCAGACATTTCTAAAATAGG + Intergenic
1043848937 8:85193576-85193598 TGATGAGAATGTTCCACATCTGG - Intronic
1043926972 8:86048413-86048435 TGATGAAATGGTCCTAAAATAGG + Exonic
1044246509 8:89953339-89953361 TGATGTGAAAGTTCAAAAACAGG - Exonic
1044334874 8:90969688-90969710 TGATAAAAATGTTCTGAAATTGG + Intronic
1044540399 8:93402631-93402653 TGATTAGGATGTTCTAGAAATGG - Intergenic
1044770728 8:95628984-95629006 TGATAAAAATGTTCTAAAACTGG - Intergenic
1045160137 8:99531218-99531240 TGATGAAAATTCTCTAAAAACGG - Intronic
1045312169 8:101012522-101012544 TGATGAAAATGTTCTAAAACTGG + Intergenic
1045359272 8:101417279-101417301 TGATGGAAATGTTCTAAAACTGG + Intergenic
1045440946 8:102210060-102210082 TGATAAAAATGTTCTAAAATAGG + Intronic
1045494518 8:102697203-102697225 TGATGAGAATGAATTATAATAGG + Intergenic
1045588643 8:103567253-103567275 TGATGAAAATATTCCAAAACTGG - Intronic
1045603373 8:103745119-103745141 TGATGAAAATGTTCTGGAATTGG - Intronic
1045648580 8:104322694-104322716 TGATGAGAGTCATGTAAAATTGG + Intergenic
1045934209 8:107659928-107659950 TGTTGAGAATGTTTAAAATTGGG - Intergenic
1045982059 8:108201348-108201370 TTATGAGAATGTTATATAAATGG - Intronic
1046078881 8:109345748-109345770 TTATGAAAATATTTTAAAATGGG + Exonic
1046821766 8:118641579-118641601 AGATGAGAATGTTTTACAATTGG + Intergenic
1046926155 8:119791348-119791370 TGATGAGATTGATTGAAAATAGG - Exonic
1047009780 8:120659302-120659324 TGGTGAAGATGTTGTAAAATTGG - Intronic
1047142525 8:122157175-122157197 TGAAGAGATTGTTTTAACATGGG + Intergenic
1047420381 8:124703115-124703137 TGGTGGAAATGTTCTAAAATTGG - Intronic
1047774777 8:128060810-128060832 TGAGGAAAATATTCTAAAATTGG - Intergenic
1047871265 8:129084830-129084852 TAATGGAAATGTTCTAAAACTGG + Intergenic
1047914499 8:129567459-129567481 TGATGGGAATGTTCTAAACCTGG + Intergenic
1047917426 8:129597030-129597052 TGGTGAAAGTATTCTAAAATTGG - Intergenic
1048592923 8:135838104-135838126 TGATGCAAATGTTCTGGAATTGG + Intergenic
1049295399 8:141831375-141831397 TGATGAACATTTTCTAAAATTGG - Intergenic
1049381142 8:142316592-142316614 TGATGGGCATGTTCTAAAACTGG - Intronic
1049955893 9:692625-692647 TTATGGGTATGTTCTAAAACTGG - Intronic
1050273071 9:3966914-3966936 TGATGAGAATGTTCTAAAACTGG - Intronic
1050426954 9:5521268-5521290 TAATGAAAATGTTCTAAAATTGG + Intronic
1050714610 9:8508462-8508484 TGATCAAAATGTTTTACAATTGG - Intronic
1051247623 9:15127355-15127377 TGATGGAAATGTTCTAAAGGTGG + Intergenic
1051263664 9:15290177-15290199 TGATAGAAATGTTCTTAAATTGG + Intronic
1051309564 9:15755850-15755872 TGATAAAAATGTTTTAAAATTGG + Intronic
1051329116 9:16005108-16005130 TGATAAGAAAGTTCTAAAATTGG - Intronic
1051503446 9:17803041-17803063 TGATGGAGATGTTCTAAAACTGG - Intergenic
1052024301 9:23557637-23557659 TGATGAAAAAGTTCTCAAAATGG + Intergenic
1052116963 9:24660692-24660714 TGATGAAAAATTTCTAAAATTGG - Intergenic
1052243707 9:26307402-26307424 TCATGAGAATATTTTAAAATCGG + Intergenic
1052251210 9:26399406-26399428 TCATGAAAATGTTCTAAAACTGG + Intergenic
1052662066 9:31445954-31445976 TGATGAAAATATTTTAAAATTGG + Intergenic
1052712765 9:32076935-32076957 TGATGAGCTTGTTGAAAAATAGG - Intergenic
1052874789 9:33549101-33549123 TGATGAAAATGTTCTAAAGTTGG + Intronic
1052990381 9:34515818-34515840 TGGTGAAAATGTTCTAAAATCGG + Intronic
1053401445 9:37827292-37827314 TGATGAAAATATGCTACAATAGG + Intronic
1053403356 9:37848613-37848635 TGATGAAAATGTTCTAAAACTGG + Intronic
1053501233 9:38595218-38595240 TGATGAAAATGTTCTAAAGTTGG - Intergenic
1053659974 9:40265666-40265688 TGATGGAAATGCTCTAAAGTTGG + Exonic
1053724597 9:40986378-40986400 TAAAGTGAATGTTCTAAAACTGG + Intergenic
1053746479 9:41203422-41203444 TGGTGAAAGTGTTCTAAAACTGG - Intergenic
1053910347 9:42895006-42895028 TGATGGAAATGCTCTAAAGTTGG + Intergenic
1054341368 9:63865625-63865647 TAAAGTGAATGTTCTAAAACTGG - Intergenic
1054372105 9:64411959-64411981 TGATGGAAATGCTCTAAAGTTGG + Exonic
1054480785 9:65661800-65661822 TGGTGAAAGTGTTCTAAAACTGG + Intergenic
1054524624 9:66110551-66110573 TGATGGAAATGCTCTAAAGTTGG - Exonic
1054679724 9:67901668-67901690 TGATGGAAATGCTCTAAAGTTGG + Exonic
1054681866 9:68227856-68227878 TGGTGAAAGTGTTCTAAAACTGG + Intergenic
1054756255 9:68961343-68961365 TGATGAAAATATTCTAAAATTGG + Intronic
1055028815 9:71751190-71751212 TGATGAAAAAGTTCTGAAAATGG - Intronic
1055051086 9:71981995-71982017 TGATGGAAATGTTCTAAAACTGG - Intronic
1055101408 9:72469608-72469630 TGATGAACATGTTCTAAAACTGG + Intergenic
1055385516 9:75757906-75757928 TGATGACAATGTTCTGGAAATGG - Intergenic
1055475046 9:76654496-76654518 TGATGAAAAGGTTCTATATTTGG + Intronic
1055631354 9:78227181-78227203 GGATAAAAATCTTCTAAAATTGG - Intergenic
1055806552 9:80101498-80101520 TGGTGAAAATGTTCTAAAATTGG - Intergenic
1055895630 9:81171884-81171906 TGATAAAAATGTTCTAAAACTGG - Intergenic
1056009112 9:82307505-82307527 TCAAGAGAATGTTATGAAATTGG + Intergenic
1056033607 9:82580788-82580810 TGATGAAAGAGTTCTAAAAATGG + Intergenic
1056070485 9:82981702-82981724 TGATGAGAATGTTCTGGAATTGG - Exonic
1056319961 9:85426595-85426617 TAATAAAAATGTTCTAAAACTGG + Intergenic
1056485193 9:87049556-87049578 TGATAAGAATGTTCTAAAATTGG + Intergenic
1057433501 9:95017743-95017765 TGATGGAAATGTTCTAAAACTGG - Intronic
1057581054 9:96288171-96288193 TGATGGAAATGTTCCAAAACCGG + Intronic
1057599117 9:96441807-96441829 TGTTGAGAATGGTGAAAAATGGG + Intergenic
1058304904 9:103427670-103427692 TAATGAGAATATTCTAATTTAGG + Intergenic
1058416152 9:104790576-104790598 TGATGGAAAAGTTCTAAAACTGG + Intronic
1059007216 9:110416606-110416628 GACTGAGAATATTCTAAAATAGG + Intronic
1059113351 9:111578009-111578031 TGATGAAAATATTCTTAAACTGG + Intronic
1059182441 9:112230038-112230060 CGTTGAAAATTTTCTAAAATTGG + Intronic
1059207775 9:112482875-112482897 TGATGAAAATATTGTAAAATTGG - Intronic
1059287333 9:113186003-113186025 TGACGGAAATGTTCTAAAATAGG + Intronic
1059303630 9:113336098-113336120 TGATGACAATGTTGAAAAATAGG - Intronic
1059566549 9:115388222-115388244 TGATGGGAAAGTTTTAAAATTGG + Intronic
1060122495 9:121007268-121007290 TTGTGAGTATATTCTAAAATAGG + Intronic
1060183412 9:121549461-121549483 TAATTAAAATGTTCTTAAATTGG + Intergenic
1060578334 9:124719478-124719500 TGATGAGAGTGTGGGAAAATGGG - Intronic
1060683688 9:125588438-125588460 TGATCGTAATGTTCTGAAATTGG + Intronic
1060775649 9:126371974-126371996 TGATGACAATGTTCAAAATTAGG - Intronic
1060861493 9:126958374-126958396 GGATGGAAATGTTCTAAAACTGG - Intronic
1061310853 9:129761421-129761443 TGATGAAAATGTTCTGGAAATGG + Intergenic
1061338469 9:129959768-129959790 TGATAAAAATATTCTAAAATTGG - Intronic
1061459485 9:130725174-130725196 TGATGAAAAAGTTCTGAAAATGG - Intronic
1061470478 9:130821237-130821259 TGCTGGAAATGTTCTAAAACTGG - Intronic
1061907539 9:133706499-133706521 TGATGAGAATGTTCTGGAACTGG + Intronic
1202782609 9_KI270718v1_random:14197-14219 TGGTGAAAGTGTTCTAAAACTGG - Intergenic
1186116969 X:6314419-6314441 TGATGAAAATATTCTAAAGTAGG - Intergenic
1186441155 X:9587738-9587760 TGATGAAAATGTTCTAAACTGGG - Intronic
1186633636 X:11378323-11378345 TGAAGAAAGTGTTCTAAAACTGG - Intronic
1186636133 X:11407084-11407106 TGATAAAAATATTCTAAAATTGG - Intronic
1186636556 X:11411891-11411913 TGACAAAAATGTTCTCAAATTGG - Intronic
1186860746 X:13670102-13670124 TGCTAAAAATGTTCTAAAATTGG + Intronic
1186861028 X:13672672-13672694 TAATGGAAATGTTCTGAAATTGG + Intronic
1186923956 X:14311666-14311688 TGGCAAAAATGTTCTAAAATTGG + Intergenic
1186948873 X:14599678-14599700 TGATGGGAATGCTCTAAATCTGG + Intronic
1186966596 X:14793420-14793442 CAATGAAAATATTCTAAAATTGG + Intergenic
1187342253 X:18431828-18431850 TGATGGAAATGTTCTAAAACTGG - Intronic
1187418192 X:19111753-19111775 TGATGGGAATGATCTAGAACAGG + Intronic
1187512751 X:19936852-19936874 TAATGAAAATATTCTAAAACTGG + Intronic
1187655014 X:21462452-21462474 AGATGATAATGATCTTAAATTGG - Intronic
1187945174 X:24419262-24419284 CGATGAGACTGTTCTAAAATTGG + Intergenic
1188279641 X:28249147-28249169 TGATGAAAATGTTTTAAAATTGG + Intergenic
1188384013 X:29533728-29533750 TGGTGAGAATGTTGAAAATTAGG - Intronic
1188407257 X:29826990-29827012 TGACGAGAATGTGGAAAAATTGG - Intronic
1188775755 X:34216271-34216293 TGATTACAAAGTTCTACAATAGG - Intergenic
1189027553 X:37413010-37413032 TGATGAAAATGTTTTATAACTGG - Intronic
1189035811 X:37492623-37492645 TGAAGAGAATGTTCTGAAAAGGG - Intronic
1189155448 X:38751877-38751899 TGATGGAAATGTTCTAAAACGGG + Intergenic
1189494272 X:41495002-41495024 TGATAAAAATGTTCTAAAATTGG - Intergenic
1189554943 X:42132681-42132703 TGATGGAAGTGTTCTAAAACTGG - Intergenic
1189933175 X:46036564-46036586 TGATGGAAATGTTCTAAAATTGG - Intergenic
1190491335 X:50985328-50985350 CGATGAAAATGTTACAAAATTGG + Intergenic
1190551182 X:51582683-51582705 GGTTGGAAATGTTCTAAAATTGG - Intergenic
1190840070 X:54135770-54135792 TGATAAGAATCTTATAAAGTAGG + Intronic
1190905566 X:54723855-54723877 TGATGAAAATGTTCTAAAACTGG - Intergenic
1191029671 X:55955037-55955059 TAATGGAAATGTTATAAAATTGG + Intergenic
1191709188 X:64130798-64130820 TGATGAAAATGTTCTGGAAATGG + Intergenic
1191782910 X:64887511-64887533 TGATGAAAATGTTTTAGAACTGG + Intergenic
1191905067 X:66079093-66079115 TGATGAAAATCTTCTAAGATGGG + Intergenic
1191980613 X:66920355-66920377 TGATGAAAATGTTCTAAATTTGG - Intergenic
1192271582 X:69585237-69585259 TGATGAGAATGTTTTAAAATTGG + Intergenic
1192374615 X:70547273-70547295 TAATGGAAATGTTCTAAAACTGG + Intronic
1192387112 X:70682074-70682096 TGAAGAGAATTTTCTAAGAAAGG + Intronic
1192420354 X:71024031-71024053 TGATGGAAATGTTTTAAAACTGG + Intergenic
1192466588 X:71361160-71361182 TGATAGAAATGTTCTAAAACTGG - Intergenic
1192478880 X:71467866-71467888 TGATGAGAATGTGGTAAACCAGG + Intronic
1192586361 X:72321419-72321441 TGATGAGCATGTACAAAAACTGG - Intergenic
1192607277 X:72531554-72531576 TGATGAAAATATTCTAAAATTGG - Intronic
1193413225 X:81190406-81190428 TCGTGAGAATGTCCTAAAATTGG - Intronic
1193759543 X:85447695-85447717 TGATAAAAATGTTCTGGAATTGG - Intergenic
1194466574 X:94241072-94241094 TAATGAAACTGTTCTAAAATTGG + Intergenic
1195331231 X:103802757-103802779 TGATGAAAATGTTCTAAGATTGG - Intergenic
1195444800 X:104939992-104940014 TGATGAAAATTTTGGAAAATTGG + Intronic
1195612748 X:106887337-106887359 TGATGGAAATGTTCTAAATTTGG - Intronic
1195631731 X:107063136-107063158 TGATGAAAGTGTTCTAAAATTGG - Intergenic
1195634460 X:107097942-107097964 TGATGGAAATGTCCTAAAATTGG + Intronic
1195721001 X:107868017-107868039 TGATGGAATTGTTCTAAAATTGG + Intronic
1195843509 X:109201269-109201291 TGGTAAAAATATTCTAAAATTGG - Intergenic
1195902139 X:109810307-109810329 TGATGAAAATGCTCTGGAATTGG + Intergenic
1196058245 X:111379306-111379328 TGATGAGAATGTTCTAAAATTGG - Intronic
1196119393 X:112032755-112032777 TGATGAAGATGTACAAAAATTGG - Intronic
1196236735 X:113290362-113290384 TGATGAAAAAGTTCTGAAAATGG - Intergenic
1196324041 X:114380382-114380404 AGATGAGAATTTTCCAAAACTGG + Intergenic
1196365210 X:114915954-114915976 TGATGGAAATGTTCTAAAACTGG + Intergenic
1196392986 X:115228735-115228757 TGATTGGGATGTTTTAAAATTGG - Intronic
1196440705 X:115717574-115717596 TTAGAAAAATGTTCTAAAATTGG - Intergenic
1196613757 X:117743538-117743560 TGAAGAGAATGTAGTAAAGTGGG + Intergenic
1196698692 X:118642353-118642375 CAATGGAAATGTTCTAAAATTGG + Intronic
1196733146 X:118961598-118961620 TGATGAAAATGTTCCAAAATTGG + Intergenic
1196761725 X:119206749-119206771 TGATGAAAACATTCTGAAATTGG + Intergenic
1197169851 X:123419851-123419873 TGATAAAAATGCTCTAAAATTGG + Intronic
1197277972 X:124502075-124502097 TGATAAAAATATTCTAAAACTGG + Intronic
1197438956 X:126466452-126466474 TGATGAAAACATTTTAAAATTGG + Intergenic
1197683608 X:129414092-129414114 TGATGAACGTGTTTTAAAATTGG + Intergenic
1197796230 X:130301241-130301263 TGATGAAAATGTGCTATAATTGG - Intergenic
1197968452 X:132090604-132090626 TGATGGAAATGTTTTAAAACTGG + Intronic
1198116972 X:133553872-133553894 TAATGAAAATGATCTAAAATTGG - Intronic
1198124986 X:133634727-133634749 TGATGGAAATGTTCCAAATTGGG + Intronic
1198151075 X:133910315-133910337 TGATGAGACTGTTTTGATATGGG - Intronic
1198188842 X:134283569-134283591 TGATGAAAATGTTCTAAAACTGG + Intergenic
1198626685 X:138583572-138583594 TGATGAGAATGTGGAGAAATTGG + Intergenic
1198874835 X:141212941-141212963 GGGTGAAAATGTTCTAAAATTGG + Intergenic
1199482984 X:148318309-148318331 TGATGAAAATGTTCTAGAATTGG + Intergenic
1199502597 X:148524545-148524567 TTATGAAAATGTTTTAAATTGGG - Intronic
1200076039 X:153551631-153551653 TGATGAAAATTTTCTGGAATTGG + Intronic
1200179628 X:154142509-154142531 TGATAAAAATGTCCTAAAATTGG - Intergenic
1200184360 X:154172365-154172387 TGATGAGAATGTTAGACAACCGG + Intergenic
1200190012 X:154209498-154209520 TGATGAGAATGTTAGACAACCGG + Intergenic
1200195765 X:154247307-154247329 TGATGAGAATGTTAGACAACCGG + Intergenic
1200201419 X:154284423-154284445 TGATGAGAATGTTAGACAACCGG + Intronic
1200254348 X:154571825-154571847 TGATGAGAATGTCCTGAAGCTGG + Intergenic
1200263421 X:154632583-154632605 TGATGAGAATGTCCTGAAGCTGG - Intergenic
1200816724 Y:7541127-7541149 TGATGAGAAAATTCTGAAACTGG + Intergenic
1200868968 Y:8076595-8076617 TGATGTGAATTTTCTATAAGGGG - Intergenic
1200892905 Y:8342583-8342605 TGATGTGAATTTTCTATAAGGGG + Intergenic
1200944535 Y:8820466-8820488 TCATTAGAATTTTCTAAAACAGG - Intergenic
1201317926 Y:12666260-12666282 TGATGAAAATGTTCTAAAACTGG - Intergenic
1201484691 Y:14480130-14480152 TGCTGAGAATGACCTAAGATGGG - Intergenic
1201557394 Y:15277664-15277686 AGATGAGTATGTTCATAAATAGG + Intergenic
1201560956 Y:15316073-15316095 TGATGGAAATGTTCTAAAACTGG - Intergenic
1202575303 Y:26317859-26317881 GGGTGAGCATGTTTTAAAATTGG - Intergenic