ID: 1135422083

View in Genome Browser
Species Human (GRCh38)
Location 16:22312150-22312172
Sequence TGTTCTAAAATTGGTTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135422081_1135422083 3 Left 1135422081 16:22312124-22312146 CCTGGTTCTTTTTGTGGTGATGA No data
Right 1135422083 16:22312150-22312172 TGTTCTAAAATTGGTTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135422083 Original CRISPR TGTTCTAAAATTGGTTGTGC TGG Intronic
No off target data available for this crispr