ID: 1135422297

View in Genome Browser
Species Human (GRCh38)
Location 16:22313526-22313548
Sequence TGGTGGGCCTAGGCCTTCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135422285_1135422297 25 Left 1135422285 16:22313478-22313500 CCAAGACTCTAGGATTGGGGGCT 0: 1
1: 0
2: 1
3: 8
4: 103
Right 1135422297 16:22313526-22313548 TGGTGGGCCTAGGCCTTCACGGG 0: 1
1: 0
2: 0
3: 8
4: 137
1135422284_1135422297 26 Left 1135422284 16:22313477-22313499 CCCAAGACTCTAGGATTGGGGGC 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1135422297 16:22313526-22313548 TGGTGGGCCTAGGCCTTCACGGG 0: 1
1: 0
2: 0
3: 8
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135422297 Original CRISPR TGGTGGGCCTAGGCCTTCAC GGG Intronic
902824298 1:18962460-18962482 TGCTGGGCCTCAGCCTTCACAGG + Intergenic
903543304 1:24108654-24108676 CCGTGGACCTTGGCCTTCACAGG - Exonic
921007208 1:211106228-211106250 TGGTGGGCCAAGACCTTGCCAGG + Intronic
1065622866 10:27600996-27601018 TGGTGGGATTAGACCTTCTCAGG + Intergenic
1069581886 10:69572244-69572266 TGGCCGGCCCAGGCCTCCACGGG - Exonic
1072221269 10:93329590-93329612 TAGAGGGCCTAGGCCTCCCCAGG + Intronic
1073071794 10:100798884-100798906 GGGTGGGGCTGGGCCTGCACAGG + Intronic
1075261871 10:120970258-120970280 TGCTGGGCCTGAGCCCTCACTGG + Intergenic
1076430068 10:130395499-130395521 TGGTGGGCCTGGGCTTCAACTGG - Intergenic
1077107604 11:848792-848814 TGGTGGGGCTGGGGCTTCAGAGG + Intronic
1077482188 11:2820956-2820978 TGCTGGGCCTCGGCCATCTCTGG + Intronic
1077614041 11:3662306-3662328 TGGTGTGCCAAGGCCTACCCAGG + Intronic
1077663220 11:4087210-4087232 TGCTGGGCATAGGGGTTCACTGG + Intronic
1080451358 11:32381360-32381382 TGCTGGGCCCCGGCCTGCACTGG - Intergenic
1082212049 11:49517268-49517290 CTGTGGGCCAAGGCCTTTACAGG - Intergenic
1082786595 11:57320599-57320621 TGTTGGGCCTCGGCCTCCCCGGG - Exonic
1083263517 11:61535779-61535801 TGGTGGCCCTTGGCTGTCACCGG - Intronic
1083278707 11:61612107-61612129 TGGTGTGTCTGTGCCTTCACAGG - Intergenic
1084561159 11:69906153-69906175 GGGTGGGCCAAGTCCTGCACTGG + Intergenic
1085309725 11:75509071-75509093 TGGTGGGCATAGGGCTTGAGGGG - Intronic
1090777137 11:129975560-129975582 TGGTGGGAATGGGACTTCACTGG + Intronic
1094107448 12:26829621-26829643 TGGTGAGCCTAGGACTTAAATGG - Intronic
1096911089 12:54984630-54984652 AGCTGGGCCGAGGCCTTCACAGG + Exonic
1098338892 12:69431600-69431622 TGGTGGCCCCAGGCATTCTCTGG - Intergenic
1102913063 12:116733153-116733175 ACGTTAGCCTAGGCCTTCACAGG - Intronic
1103930196 12:124446023-124446045 TGGTGGGACGGGGCCTGCACGGG + Intronic
1103944502 12:124518458-124518480 CGGTGGGCCTTGGCCTGCCCGGG - Intronic
1107151319 13:37115347-37115369 TGGTGAGCTTGGGCCTTCAGTGG + Intergenic
1110983707 13:81937508-81937530 GGGTTGGCCTAGGCCTTACCTGG - Intergenic
1118149978 14:63179037-63179059 AGTTGGACCTAGGCCTGCACAGG + Intergenic
1119166770 14:72501098-72501120 AGGTGGGCTTTGGACTTCACTGG + Intronic
1122577683 14:102752238-102752260 AGGAGGGCCTAGGCCTGCCCAGG - Intergenic
1123105662 14:105840029-105840051 TGCTGGGCACAGGCCTTCCCTGG - Intergenic
1123499391 15:20866466-20866488 TGGTGGGCGTGGGCTTTCCCCGG - Intergenic
1123556643 15:21440196-21440218 TGGTGGGCGTGGGCTTTCCCCGG - Exonic
1123592865 15:21877431-21877453 TGGTGGGCGTGGGCTTTCCCCGG - Intergenic
1123778753 15:23605159-23605181 TGGTGGGCCAAGACCTGCAGAGG - Intronic
1125335566 15:38623065-38623087 TGGTGGGGTCAGGCGTTCACAGG - Intergenic
1125524031 15:40364254-40364276 AGGTAGGCCTGGGCCTTCCCTGG + Exonic
1127810651 15:62562361-62562383 TTGTGGCCCTCGTCCTTCACTGG + Intronic
1128144785 15:65327052-65327074 GGGTGGGCCAGGGCCCTCACAGG - Intergenic
1128168731 15:65491464-65491486 TGTTGGGACTGGGCCTTGACTGG - Intronic
1130790521 15:87150759-87150781 TGGTGGGCTTATGCACTCACTGG - Intergenic
1132382222 15:101374203-101374225 TGGTGGGCCTTCGCCTCCTCAGG - Intronic
1202964982 15_KI270727v1_random:167385-167407 TGGTGGGCGTGGGCTTTCCCCGG - Intergenic
1133237404 16:4393693-4393715 TGATGGGCCTAGGTCTTTGCTGG + Intronic
1135249594 16:20889823-20889845 TGGTTTGGCTAGCCCTTCACTGG - Intronic
1135422297 16:22313526-22313548 TGGTGGGCCTAGGCCTTCACGGG + Intronic
1136136362 16:28259039-28259061 CGGAGGGCCTAGGGCTCCACAGG + Intergenic
1139470439 16:67175263-67175285 TGGTGGGCTTGGGCCTGCCCAGG - Exonic
1141812895 16:86387893-86387915 TGGTGGCCCCAGGCATTCCCTGG + Intergenic
1142754416 17:2007486-2007508 TGAGAGGCCAAGGCCTTCACAGG - Intronic
1146053362 17:29568846-29568868 TCGCGGGCCGAGGCCTTCCCAGG - Intronic
1147599895 17:41739012-41739034 TTGAGGGCCTAGGCCCTCAGAGG + Intergenic
1148911641 17:50946192-50946214 TGTTGGGCCTCAGCCTTCACAGG - Intergenic
1150699873 17:67437403-67437425 TGGTGGCCCCAGGCGTTCCCTGG - Intronic
1151401944 17:73861438-73861460 TGGTGGGCCCAGGTCTCCTCCGG + Intergenic
1151680967 17:75622511-75622533 TGGTGGGTCCAGGCCACCACAGG + Intergenic
1151930337 17:77228096-77228118 GGGTGGCCCTAGCCCATCACTGG - Intergenic
1152310653 17:79547876-79547898 TGGAGGTCCGAGTCCTTCACTGG - Intergenic
1152581987 17:81169659-81169681 TGGTGGCCCTAGGCCTTCCTGGG + Intergenic
1152829547 17:82488809-82488831 TGGGGGTCCTAGCTCTTCACAGG - Exonic
1154457450 18:14543331-14543353 TGGTGGGCGTGGGCTTTCCCCGG - Intronic
1158961560 18:62591835-62591857 TGGTGGTCCTTGGACTGCACTGG - Intergenic
1159346999 18:67218805-67218827 TCATTGGCCTAGGCCTACACAGG - Intergenic
1160081570 18:75732014-75732036 CCTTGGGCCTTGGCCTTCACGGG - Intergenic
1160770401 19:828441-828463 TGGGGGGCTTAGGCATTCAGTGG + Intronic
1160922127 19:1525960-1525982 TGATGGGCCCAGGCGGTCACAGG - Intronic
1161800017 19:6412353-6412375 GGGTGGGCCTTGCCCCTCACCGG + Intergenic
1164407125 19:27960315-27960337 TGGTGGTCCTTGGCTTTCATTGG + Intergenic
1165738073 19:38189979-38190001 TGGTGGGCCTGGCCCTTTCCTGG + Intronic
1166233245 19:41438171-41438193 TGGTGGGCCAGGGTCTCCACAGG + Intronic
1166753789 19:45178403-45178425 GGGCGGGCCTACGCCTTCTCTGG + Intronic
925311093 2:2882293-2882315 GTGTTGGGCTAGGCCTTCACTGG + Intergenic
925502552 2:4522509-4522531 TGTTGGCCCTGGGCCTTCAGGGG - Intergenic
925760697 2:7181672-7181694 TGGTGGCTCTTGGCCTACACTGG + Intergenic
926596675 2:14797413-14797435 TGGTGGGGCTAGGCCAGCCCAGG + Intergenic
926751628 2:16202852-16202874 TGCTCTGCCCAGGCCTTCACAGG - Intergenic
927637050 2:24824283-24824305 CGCTGGGCCCAGGCCTTCTCAGG - Intronic
927810111 2:26175827-26175849 TGCAGGGCCTAGGCCCTGACTGG + Intronic
933724568 2:85419127-85419149 TGGAGGACCCAGGCCTTCCCCGG - Intronic
934895488 2:98116194-98116216 TGGTTGGCCTGGGTCTGCACAGG - Intronic
935267464 2:101407221-101407243 TGGTGTGCCAAGGATTTCACTGG - Intronic
936618519 2:114072392-114072414 AGGTGGTCCTGGGCCATCACTGG + Intergenic
937182750 2:120011336-120011358 TGCTGGGCATAGCCCTTCATAGG + Intergenic
937287158 2:120760954-120760976 AGGTGGGCCTTGTCCTGCACAGG + Intronic
938261042 2:129895319-129895341 AGGAGGGGCTAGGCCTTCCCGGG - Intergenic
944922941 2:204434436-204434458 TGGTGGGTCTAGGCATTCCTTGG - Intergenic
1168767320 20:390500-390522 TGCTGGCCCTGGGCCTGCACGGG - Intronic
1169313388 20:4567700-4567722 TTCTGAGCCTAGGCCTTCAGAGG - Intergenic
1173189279 20:40863733-40863755 TGGTGGCCCCAGGCCTTCCTTGG - Intergenic
1173764334 20:45593560-45593582 TGATGTGCCTAGGTGTTCACTGG + Intergenic
1176120444 20:63452125-63452147 TGCTGGGCCAGAGCCTTCACAGG - Intronic
1176816707 21:13610022-13610044 TGGTGGGCGTGGGCTTTCCCCGG + Intronic
1177969661 21:27773594-27773616 AGGTTTGCCTAGTCCTTCACTGG - Intergenic
1178306624 21:31496072-31496094 TCATTGGCCTAGGCCTACACAGG - Intronic
1179059750 21:37968719-37968741 TGGTGGGCGTAGAACTTCCCAGG + Intronic
953405959 3:42659868-42659890 AGGTGGGGCTAGGCCATAACTGG + Intronic
954415384 3:50390917-50390939 TGGCTGGCCTAGGCCTGCACAGG - Intronic
954726481 3:52615617-52615639 GGGAGAGCCTAGGCCTTAACTGG + Intronic
956746488 3:72314903-72314925 TGCTGGGCATAGGGCTTCAGTGG + Intergenic
958973383 3:100638150-100638172 TGCTGGCCCTTTGCCTTCACTGG - Intronic
964735555 3:159913656-159913678 TGGATAGCCTAGGCCTTCTCTGG + Intergenic
965672791 3:171164097-171164119 TGGTGGCCCTAAGCCTAAACAGG + Intronic
966146432 3:176817153-176817175 TGGTGGGCCAAGGCCGGCAGAGG + Intergenic
968656833 4:1782365-1782387 TGCTGGGGCTAGGGCTGCACTGG - Intergenic
972638462 4:40904977-40904999 TAGTGGGCCCAGGGCTTCAAAGG - Intronic
999347362 5:150836239-150836261 TCCTGGCCCTGGGCCTTCACCGG + Intergenic
999572313 5:152933597-152933619 TGGTTGGCCAATACCTTCACCGG + Intergenic
1001204296 5:169747607-169747629 TGGCCAGCCCAGGCCTTCACTGG - Intronic
1002611719 5:180423792-180423814 TGGTGGCCCCAGGCCTTCCCTGG + Intergenic
1002765020 6:232058-232080 GGGAGGGCCTGGGCTTTCACGGG - Intergenic
1004924665 6:20404404-20404426 TGGTGAGGCTTGGCCTCCACGGG + Intronic
1005887635 6:30108862-30108884 TGGTTGGCATAGGCATTCCCCGG + Intronic
1006517389 6:34552566-34552588 TGGAGGGCCTCTGCCTTCCCTGG - Intronic
1011866454 6:91834698-91834720 TGGTGGCCCCAGGCATTCCCTGG - Intergenic
1014955402 6:127608855-127608877 TTGTGGGCCCAGCCCTTCCCTGG + Intergenic
1018743084 6:166744859-166744881 TAGGGGGCCTGGGCCTTCCCCGG + Intronic
1022843512 7:34188457-34188479 ACATTGGCCTAGGCCTTCACAGG + Intergenic
1028401867 7:90433367-90433389 TGGTGGGGCTAGGCCAGCCCAGG - Intronic
1029174857 7:98657554-98657576 TGGTGGCCCCAGGCCATCCCTGG - Intergenic
1032785533 7:135196872-135196894 TGGTGGGCCTAGGGGTGCACTGG - Intronic
1034991688 7:155551519-155551541 TGGTGGTCCTGGGCCTTCCTTGG - Intergenic
1037438134 8:18886321-18886343 TGCTGGGCATAGGCATTCAGAGG + Intronic
1037554432 8:20008444-20008466 TGGTGGGGTTAGGGCTTCAAAGG + Intergenic
1037885086 8:22591686-22591708 TGGGGGACCTGAGCCTTCACAGG + Intronic
1038259135 8:25978235-25978257 AGGTGGGCCTGGGGCTTCCCTGG - Intronic
1046778636 8:118191391-118191413 TGGTGGGTGTTGGCCCTCACTGG - Intronic
1049246610 8:141566071-141566093 AGGTGGGCCCAGGGCTTCCCAGG - Intergenic
1049695790 8:143983762-143983784 TGGAGGGCCTAGACCTAGACGGG - Exonic
1050115780 9:2261788-2261810 TGGTGTATCCAGGCCTTCACTGG + Intergenic
1054823222 9:69544877-69544899 CGGTGGGCCAAGGCCCTCCCTGG - Intronic
1056677493 9:88687597-88687619 TGATGGGACTAGGCATTTACAGG + Intergenic
1058610015 9:106765480-106765502 TTTTGGTCCTAGGCCTGCACGGG - Intergenic
1061473220 9:130843963-130843985 TTGAGGGCCTAGGCATGCACAGG - Intronic
1061881735 9:133572310-133572332 GGGTGGGCCTGGGGCTTCCCAGG + Intronic
1062340378 9:136091410-136091432 TGCTGGGCCTGGGTCCTCACTGG - Intronic
1203530654 Un_GL000213v1:139472-139494 TGGTGGGCGTGGGCTTTCCCCGG - Intergenic
1187065550 X:15833856-15833878 TAGTAGGCCTAGGCCTGCACAGG - Intronic
1187096739 X:16156666-16156688 TCTTGGGCCTAGGCTTTCATGGG + Intergenic
1187975746 X:24703245-24703267 TGGTAGGTCGAGGACTTCACAGG + Exonic
1188595241 X:31892332-31892354 TGATGGGCATAGAACTTCACCGG + Intronic
1189107818 X:38255704-38255726 CTGTGGGCCTAGGCCTTTATCGG - Intronic
1189365831 X:40387737-40387759 CTGTGGGCCTAGGCCTTTATCGG - Intergenic
1190742783 X:53301249-53301271 CTGTGGGCCTGGGCCTTCAGAGG - Intronic
1201411337 Y:13702435-13702457 TGGGGCGCATAGGCCTCCACTGG + Intergenic