ID: 1135427378

View in Genome Browser
Species Human (GRCh38)
Location 16:22350252-22350274
Sequence AGCCCCACCCCAACAAGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135427378_1135427380 0 Left 1135427378 16:22350252-22350274 CCAACTCTTGTTGGGGTGGGGCT No data
Right 1135427380 16:22350275-22350297 GACATAGAGTCTCCATCTCTGGG No data
1135427378_1135427379 -1 Left 1135427378 16:22350252-22350274 CCAACTCTTGTTGGGGTGGGGCT No data
Right 1135427379 16:22350274-22350296 TGACATAGAGTCTCCATCTCTGG 0: 1
1: 0
2: 2
3: 14
4: 293
1135427378_1135427381 8 Left 1135427378 16:22350252-22350274 CCAACTCTTGTTGGGGTGGGGCT No data
Right 1135427381 16:22350283-22350305 GTCTCCATCTCTGGGCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135427378 Original CRISPR AGCCCCACCCCAACAAGAGT TGG (reversed) Intronic
No off target data available for this crispr