ID: 1135435708

View in Genome Browser
Species Human (GRCh38)
Location 16:22425473-22425495
Sequence CGCTGTTCCCAGAGTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135435708_1135435712 -4 Left 1135435708 16:22425473-22425495 CCATCCTCACTCTGGGAACAGCG No data
Right 1135435712 16:22425492-22425514 AGCGTCCTCGGCTGTCCTGCGGG No data
1135435708_1135435711 -5 Left 1135435708 16:22425473-22425495 CCATCCTCACTCTGGGAACAGCG No data
Right 1135435711 16:22425491-22425513 CAGCGTCCTCGGCTGTCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135435708 Original CRISPR CGCTGTTCCCAGAGTGAGGA TGG (reversed) Intronic
No off target data available for this crispr