ID: 1135444221

View in Genome Browser
Species Human (GRCh38)
Location 16:22504460-22504482
Sequence CTCCATCTTAAATAGGAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135444221_1135444226 22 Left 1135444221 16:22504460-22504482 CCCGGCTCCTATTTAAGATGGAG No data
Right 1135444226 16:22504505-22504527 GACATGATCATTGCCCACTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135444221 Original CRISPR CTCCATCTTAAATAGGAGCC GGG (reversed) Intronic
No off target data available for this crispr