ID: 1135447911

View in Genome Browser
Species Human (GRCh38)
Location 16:22534546-22534568
Sequence TATCATCTGCTGAGGGTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 2, 1: 54, 2: 11, 3: 22, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135447911_1135447915 6 Left 1135447911 16:22534546-22534568 CCTTCCACCCTCAGCAGATGATA 0: 2
1: 54
2: 11
3: 22
4: 186
Right 1135447915 16:22534575-22534597 AGACACCTGCCGAGCGTCTGCGG 0: 70
1: 8
2: 7
3: 7
4: 80
1135447911_1135447917 8 Left 1135447911 16:22534546-22534568 CCTTCCACCCTCAGCAGATGATA 0: 2
1: 54
2: 11
3: 22
4: 186
Right 1135447917 16:22534577-22534599 ACACCTGCCGAGCGTCTGCGGGG 0: 70
1: 7
2: 1
3: 1
4: 46
1135447911_1135447921 28 Left 1135447911 16:22534546-22534568 CCTTCCACCCTCAGCAGATGATA 0: 2
1: 54
2: 11
3: 22
4: 186
Right 1135447921 16:22534597-22534619 GGGGCCGCTTCCACCCTCAGCGG 0: 58
1: 3
2: 1
3: 10
4: 146
1135447911_1135447918 9 Left 1135447911 16:22534546-22534568 CCTTCCACCCTCAGCAGATGATA 0: 2
1: 54
2: 11
3: 22
4: 186
Right 1135447918 16:22534578-22534600 CACCTGCCGAGCGTCTGCGGGGG 0: 65
1: 7
2: 1
3: 3
4: 137
1135447911_1135447916 7 Left 1135447911 16:22534546-22534568 CCTTCCACCCTCAGCAGATGATA 0: 2
1: 54
2: 11
3: 22
4: 186
Right 1135447916 16:22534576-22534598 GACACCTGCCGAGCGTCTGCGGG 0: 69
1: 8
2: 1
3: 4
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135447911 Original CRISPR TATCATCTGCTGAGGGTGGA AGG (reversed) Exonic
902584052 1:17427248-17427270 TGCCCTCTGCTGAGGGCGGAGGG - Intronic
904005164 1:27359813-27359835 CCTCATCTGCTGAGGGTGGCGGG - Intronic
904300009 1:29548164-29548186 GATTACATGCTGAGGGTGGAGGG + Intergenic
905873635 1:41418745-41418767 ACTCCTCTGCTGGGGGTGGAGGG + Intergenic
907982569 1:59498556-59498578 AATCACCTGGTGAGGGAGGATGG + Intronic
908148590 1:61274862-61274884 TATTCTCTGCTGAGGATGCATGG - Intronic
918126308 1:181587195-181587217 GGTCATCAGCAGAGGGTGGAAGG + Intronic
918461312 1:184779648-184779670 TTTATTCTGCTGAGGGTGGTAGG - Intergenic
919012919 1:191988424-191988446 TTGCAGCTGCTGAGGTTGGAAGG - Intergenic
919235909 1:194842324-194842346 TCTCATCTGCTGAAGCTGGAGGG + Intergenic
919949986 1:202354267-202354289 TGTCATGGGCTGAGGGTGGGAGG - Intronic
921558107 1:216623577-216623599 TATCAACTTCTGAGGGTGTAAGG + Intronic
923358838 1:233187781-233187803 TATCTGCTGCTGAGGATGAAGGG - Intronic
1063227905 10:4033688-4033710 AACCATCTGGTGTGGGTGGAAGG - Intergenic
1063355577 10:5395470-5395492 TCCCATCTGCAGAGGGTGAAAGG + Exonic
1064105958 10:12501355-12501377 TATCATCTGGTGAGGGGCGAGGG + Intronic
1064557911 10:16566248-16566270 TATCATCTTCTGAGGGTGACAGG - Intergenic
1065677048 10:28187535-28187557 TATCATTTGCTTTGGGTGGGAGG - Intronic
1068583775 10:58773509-58773531 TATCATCACCTGAGGGCTGATGG + Intronic
1069741926 10:70690372-70690394 TCTCCTCTGCAAAGGGTGGAAGG - Intronic
1073934071 10:108609605-108609627 TAGAGTCTACTGAGGGTGGAGGG + Intergenic
1074150856 10:110758630-110758652 TATCATCGGCGGCAGGTGGAGGG - Intronic
1075823741 10:125335974-125335996 TGTCATCTGCTGTATGTGGAAGG + Intergenic
1077677099 11:4204696-4204718 TATCATCTCCTCAGAGAGGATGG - Intergenic
1078131492 11:8617848-8617870 TATCCTCTTCAGAGTGTGGATGG - Exonic
1078841556 11:15080318-15080340 GATCAGAGGCTGAGGGTGGAAGG - Intronic
1080006207 11:27409820-27409842 TAGCTTCTGCTGAGTGTTGAAGG - Intronic
1080243334 11:30152295-30152317 TATCATCTGCTGAGCCCTGAAGG + Intergenic
1080546235 11:33321773-33321795 GATAATCTTCTGAGTGTGGAAGG + Intronic
1080792589 11:35535170-35535192 TGTCATCTGCTTTGTGTGGAAGG + Intergenic
1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG + Intergenic
1083987063 11:66222439-66222461 TGTGATCTGCTGAGGGAGCAGGG - Intronic
1084795190 11:71500761-71500783 TATCCCCTGCTGTGGCTGGACGG + Intronic
1085977170 11:81671728-81671750 TATCAGCAGCTCAGGGTGCAAGG + Intergenic
1086931609 11:92699710-92699732 TATCATCTGCAGAGGGAAGTAGG + Intronic
1088649951 11:111948718-111948740 GTTTATCTGCTGAGGGTGAAAGG - Intronic
1088675377 11:112187557-112187579 GTTTATCTGCTGAGGGTGAAAGG - Intronic
1091836696 12:3591164-3591186 TATCGTGTGCTGAGAGGGGAGGG + Intronic
1092225784 12:6747551-6747573 TCTCAACTACTGTGGGTGGAGGG + Intergenic
1095740350 12:45600019-45600041 GATCAGCTTCTGAGGTTGGATGG - Intergenic
1097159678 12:57037507-57037529 TAGCATTTGGTGAGGGTAGAAGG - Intronic
1097347764 12:58513588-58513610 TTTCATTTCCTGAGGGTGAAGGG + Intergenic
1100119231 12:91348855-91348877 GATCAGATACTGAGGGTGGAAGG + Intergenic
1101407377 12:104440702-104440724 TGTCACCTGCTGAGTGGGGAGGG + Intergenic
1101491168 12:105210984-105211006 TGTCATTTGCTGAGGGTAGCAGG - Intronic
1101702135 12:107184027-107184049 TTTCATCTGCTAAGGCTGGATGG + Intergenic
1103690558 12:122770424-122770446 CATCATCTGCTCTGAGTGGAAGG + Exonic
1106538067 13:30665446-30665468 GATCATCAGCTGAGGGTGTGAGG + Intergenic
1106853615 13:33822042-33822064 AATCATATGCTGAGTGTGGATGG + Intronic
1106920726 13:34560762-34560784 TTCCATCTGCTGGGGTTGGAAGG + Intergenic
1112371179 13:98795125-98795147 TATGATCTGGTGAGCGTAGAAGG - Intronic
1112622839 13:101069466-101069488 AATCTTCTGCTGGTGGTGGAGGG + Intronic
1117123033 14:52589464-52589486 TATCATCTGAAGAGGGTGGATGG + Intronic
1122255170 14:100471136-100471158 TCTCTGCTGCTGAGGGTGGTTGG + Intronic
1126982545 15:54260376-54260398 GATCATATGCTGAGAATGGAGGG + Intronic
1129644218 15:77415599-77415621 GATCATCTGCTAAGAGTGAAGGG - Intronic
1131426144 15:92346915-92346937 TATCACCTGCTGAGACTGGGTGG + Intergenic
1133985443 16:10664815-10664837 TCTCATCTGCTGATGTGGGAGGG - Intronic
1134165712 16:11927681-11927703 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134495022 16:14726128-14726150 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134495045 16:14726256-14726278 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134500406 16:14765248-14765270 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134500429 16:14765376-14765398 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134526946 16:14951860-14951882 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134526969 16:14951988-14952010 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134545434 16:15104362-15104384 TATCATCCACTGAGGGTGGAAGG + Intronic
1134545469 16:15104560-15104582 TATCATCCGCTGAGGGTGGAAGG + Intronic
1134580151 16:15363674-15363696 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134580185 16:15363871-15363893 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134714512 16:16350268-16350290 TATCATCCGCTGAGGGTGGAAGG - Intergenic
1134714534 16:16350394-16350416 TATCATCCGCTGAGGGTGGAAGG - Intergenic
1134714556 16:16350522-16350544 TATCATCCGCTGAGGGTGGAAGG - Intergenic
1134722387 16:16393632-16393654 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134722409 16:16393758-16393780 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134722431 16:16393886-16393908 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134944996 16:18317983-18318005 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134945018 16:18318111-18318133 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134945040 16:18318237-18318259 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134952260 16:18358136-18358158 TATCATCCGCTGAGGGTGGAAGG + Intergenic
1134952282 16:18358264-18358286 TATCATCCGCTGAGGGTGGAAGG + Intergenic
1134952304 16:18358390-18358412 TATCATCCGCTGAGGGTGGAAGG + Intergenic
1135310926 16:21404063-21404085 GATCATCCGCTGAGGGTGGAAGG + Intronic
1135310977 16:21404354-21404376 TATCATCTGCTGAGGGTGGAAGG + Intronic
1135311051 16:21404786-21404808 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135311075 16:21404924-21404946 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135311084 16:21404981-21405003 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135311094 16:21405038-21405060 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135311104 16:21405095-21405117 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135363876 16:21836500-21836522 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364002 16:21837237-21837259 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364026 16:21837375-21837397 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364036 16:21837432-21837454 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364046 16:21837489-21837511 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364056 16:21837546-21837568 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135447786 16:22533802-22533824 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447796 16:22533859-22533881 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447806 16:22533916-22533938 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447815 16:22533973-22533995 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447839 16:22534111-22534133 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447911 16:22534546-22534568 TATCATCTGCTGAGGGTGGAAGG - Exonic
1135447939 16:22534710-22534732 GATCATCCGCTGAGGGTGGAAGG - Exonic
1135507719 16:23053141-23053163 TAGCCACTGCTGGGGGTGGAGGG - Intergenic
1135973900 16:27093417-27093439 TATATTCTGCTGATGTTGGATGG - Intergenic
1136150259 16:28342990-28343012 TATCATCCACTGAGGGTGGAAGG + Exonic
1136166496 16:28456828-28456850 TATCATCCACTGAGGGTGGAAGG + Exonic
1136196477 16:28658204-28658226 TATCATCCACTGAGGGTGGAAGG - Exonic
1136212817 16:28772329-28772351 TATCATCCACTGAGGGTGGAAGG - Exonic
1136257543 16:29052248-29052270 TATCATCCGCTGAGGGTGGAAGG - Exonic
1136307775 16:29383896-29383918 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136307800 16:29384034-29384056 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136307810 16:29384091-29384113 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321131 16:29485093-29485115 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321170 16:29485326-29485348 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321195 16:29485464-29485486 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321205 16:29485521-29485543 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321214 16:29485578-29485600 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321224 16:29485635-29485657 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136343969 16:29663473-29663495 TCTAAGCTGCTGAGGCTGGAGGG + Intronic
1136435746 16:30224685-30224707 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435851 16:30225296-30225318 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435876 16:30225434-30225456 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435885 16:30225491-30225513 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435894 16:30225548-30225570 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435904 16:30225605-30225627 TATCATCCGCTGAGGGTGGAAGG + Exonic
1138000652 16:53275661-53275683 TATCATTTGCTGAGAATGGGGGG - Intronic
1140367236 16:74391567-74391589 TATCATCCACTGAGGGTGGAAGG - Exonic
1143314972 17:6025683-6025705 TAGCATGATCTGAGGGTGGAGGG + Intronic
1143782503 17:9236636-9236658 TGAGATCTGCTGGGGGTGGAAGG + Intronic
1144626041 17:16844945-16844967 TAGCACCTGCTGCGGGTGGGAGG - Intergenic
1144880393 17:18427775-18427797 TAGCACCTGCTGCGGGTGGGAGG + Intergenic
1145151842 17:20516612-20516634 TAGCACCTGCTGCGGGTGGGAGG - Intergenic
1146679611 17:34797652-34797674 CATCATCTTCTGAGGGAGCAAGG - Intergenic
1149109271 17:53007624-53007646 TGTCATCTGGTGGGGGAGGATGG + Intergenic
1149354103 17:55822042-55822064 AATCAGGTGCTGGGGGTGGAGGG - Intronic
1149866160 17:60152123-60152145 TAACCTCTGGTCAGGGTGGATGG + Intronic
1151166382 17:72207314-72207336 TATCCTCTGCTGATGGTAGTTGG - Intergenic
1151424336 17:74020794-74020816 TTTCATTTGCTGAGGAGGGAGGG - Intergenic
1152962135 18:86384-86406 CTTCATCAGGTGAGGGTGGAGGG - Intergenic
1153981319 18:10313058-10313080 TATAATCTCCTGGGGCTGGACGG - Intergenic
1154116968 18:11619721-11619743 TATCATCCACTGAGGGTGGAAGG + Intergenic
1159126955 18:64235183-64235205 TATTATATGATGAGGGAGGAAGG + Intergenic
1159644164 18:70897925-70897947 GATAATCTGCTGAGGATGAAGGG - Intergenic
1160221429 18:76980635-76980657 TAGCATTTGCTGAGGGAGGTCGG - Intronic
1162044406 19:7988971-7988993 GGTCATCAGCTGAGGGTGAAGGG + Intronic
1162424184 19:10584062-10584084 GATCAATGGCTGAGGGTGGAAGG + Exonic
1163132795 19:15286206-15286228 TCTCATCTGCTCGGGGTGGAGGG - Intronic
1164851748 19:31489895-31489917 TCTCATTTGCTGGGGGTGGAGGG + Intergenic
925373026 2:3361534-3361556 TTACATCTGCTGTGAGTGGAAGG - Intronic
925887152 2:8402691-8402713 TATCATCTACTTAGAGTAGATGG + Intergenic
926666100 2:15524937-15524959 TAGCATCAGCTGTGGGTTGAGGG - Intronic
927482085 2:23462081-23462103 TCTCAGCTGCTGAGGGAGGCAGG + Intronic
927500017 2:23576442-23576464 TGTCATCTGCTGAGATTAGAAGG + Intronic
927881338 2:26692176-26692198 TATGCTGTGATGAGGGTGGAGGG + Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
931376897 2:61715972-61715994 CAACCTCTGCTGAGGGTTGAAGG - Intergenic
933645203 2:84807094-84807116 GATCATCTGCTGAGACTGAAGGG + Intronic
934686032 2:96322250-96322272 AGTGATCTTCTGAGGGTGGAGGG - Intergenic
934695876 2:96399833-96399855 TAACATCTGCTGCTGATGGAGGG + Intergenic
936025360 2:109027528-109027550 TATCATAAACAGAGGGTGGATGG - Intergenic
937476582 2:122220496-122220518 TATCATCTGCTGAAGGAGGAGGG - Intergenic
940307594 2:152243290-152243312 TATCACATGCTCAGGCTGGAGGG - Intergenic
941182927 2:162283381-162283403 TAACATCTGCTGAAGGTAGCTGG + Intronic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
947917917 2:233846550-233846572 TATCCTCTGCTGAGTGGGGCTGG + Intronic
1169388890 20:5173594-5173616 TATCATCTGCAGAGACTGGCAGG - Exonic
1173062834 20:39678770-39678792 TTTCATTTGCTGAGGTTGGCTGG + Intergenic
1173541900 20:43859702-43859724 TAGCATCTGCAGAGGTTTGAGGG - Intergenic
1174971323 20:55278952-55278974 GGTACTCTGCTGAGGGTGGAGGG - Intergenic
1175391339 20:58629321-58629343 TGTCATCTGCAGAGGCTGGCTGG - Intergenic
1176431564 21:6579335-6579357 GTCCATCTGCTGAGTGTGGAAGG - Intergenic
1176970301 21:15257394-15257416 TCTCATTTGCTGATGGTTGAGGG + Intergenic
1178455170 21:32742466-32742488 TATCACTTCCTCAGGGTGGAAGG + Intronic
1179354608 21:40647709-40647731 TATTATCTGATGAGGTTTGAAGG - Intronic
1179706958 21:43186797-43186819 GTCCATCTGCTGAGTGTGGAAGG - Intergenic
1180858133 22:19061035-19061057 TATCAGCTAATGATGGTGGAAGG - Intronic
1182159406 22:28106471-28106493 TATCATCTGCTGTGGGATGTGGG - Intronic
1183614995 22:38938625-38938647 GGTCATCTGCTGCCGGTGGAGGG + Intergenic
1183931103 22:41236723-41236745 TCTCTTCTGCTGAGGGAAGATGG - Intronic
1184339852 22:43880264-43880286 TATCAGGTCCAGAGGGTGGAAGG - Exonic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184585042 22:45442183-45442205 TTTCATCTACTGAGTCTGGAAGG + Intergenic
1184668473 22:46000823-46000845 CATCATCTGCCCAGGGTGGAAGG - Intergenic
950665985 3:14495167-14495189 GAGCATCTGCTGAGGGAGGTTGG - Intronic
954304337 3:49717537-49717559 TCTCAGCCCCTGAGGGTGGACGG + Exonic
955963966 3:64368978-64369000 TATCAGCTGGGGAGGGTGGCAGG + Intronic
956984619 3:74684354-74684376 TGTCATCTGGTGAGACTGGAAGG + Intergenic
961345156 3:126259499-126259521 CATCATCTGCTGAGGGGAAAGGG + Intergenic
962362214 3:134752045-134752067 CAGCATGTGTTGAGGGTGGATGG + Intronic
964344495 3:155742835-155742857 TTTCATTTGCTGATGGTGGGAGG + Intronic
964673775 3:159255194-159255216 TATCTTCTCCTGGGGGTGGAGGG + Intronic
965436141 3:168654153-168654175 TATCATATGCTGAGGATGACTGG - Intergenic
965632411 3:170746802-170746824 GATTATTTGCTGAGGGTGGAGGG - Intronic
966648920 3:182276909-182276931 TATACTCTGCTGAGAGAGGAAGG - Intergenic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967452100 3:189637027-189637049 TCTCAGCAGCTCAGGGTGGAAGG + Intronic
969388776 4:6875118-6875140 TGTCCTCTGCTGAGGCTGGGAGG - Intronic
972331142 4:38065380-38065402 TATCAGCTGCTGCGGCTTGAGGG - Intronic
978260728 4:106754604-106754626 TATCAGAGGCTGAGGGTAGAAGG - Intergenic
982106520 4:152016205-152016227 CGGCATCTGATGAGGGTGGAAGG - Intergenic
982239161 4:153281208-153281230 TTTCATATGCTGTGGGTGGAAGG + Intronic
983082406 4:163402813-163402835 GATCATCTGCTGAGAGTGCAAGG + Intergenic
985578722 5:685601-685623 TCTCTTCTTCTGAGGGCGGAGGG - Intronic
988352752 5:30133021-30133043 TATACTCTGCTGATGTTGGATGG + Intergenic
988933288 5:36058348-36058370 TATCAGGGGCTGAAGGTGGAGGG + Intronic
989049174 5:37301931-37301953 TATCTTCAGCAGAGGGTGGAAGG - Intronic
990254583 5:53953605-53953627 TTTCATATGAAGAGGGTGGAGGG + Intronic
990905513 5:60798447-60798469 TTTAACTTGCTGAGGGTGGAGGG + Intronic
991596320 5:68310326-68310348 TATCTTCTGCTGGGGGTGGGGGG + Intergenic
994392856 5:99206375-99206397 TAACATCTGGGGAGGGGGGAAGG - Intergenic
995565635 5:113431089-113431111 GATTATCTGCTGAGGGAGAAAGG + Intronic
996346539 5:122493927-122493949 CATCTTCAGCTGAGAGTGGAGGG - Intergenic
997755622 5:136396390-136396412 CATCATCTGCTGTTGGTGGATGG - Intronic
997824002 5:137090402-137090424 TGTGATCTGCAGAGGGAGGAAGG - Intronic
997865060 5:137454497-137454519 CAAAATCTGCTGAGGCTGGAGGG + Intronic
998800932 5:145868084-145868106 TATCAACTTCTGGGGGTGGGAGG + Intronic
1000233683 5:159338096-159338118 TATCATGGGCCAAGGGTGGAAGG - Intergenic
1001670368 5:173468552-173468574 TATCATCTGCTGATAGTCGAAGG + Intergenic
1003275527 6:4647497-4647519 TTTCATTTGCTGAGGGTGTGAGG + Intergenic
1005353601 6:24960858-24960880 TAACATGTGCTGTGGTTGGAAGG - Intronic
1006683200 6:35811915-35811937 TGTCATGTTCTGGGGGTGGAGGG + Intronic
1007073907 6:39054765-39054787 CAGCAGCTGCTGGGGGTGGAGGG - Intronic
1012237197 6:96832624-96832646 TATTATATCATGAGGGTGGAGGG + Intronic
1013653081 6:112216117-112216139 AACCAGCTGCTGAGGGTGGTGGG + Intronic
1018164164 6:161078100-161078122 GATCATCTGCTGAGAATGGGTGG + Intronic
1019694751 7:2438987-2439009 GACCAACTGCTGAGGGAGGAAGG + Intergenic
1019778115 7:2924360-2924382 TGTCATCTGCAGAGGGACGAGGG + Exonic
1020724356 7:11791452-11791474 TATCCTTTGTTGAGGGTTGAAGG + Intronic
1021558106 7:21942142-21942164 GATCATCAGCTGAGGATAGAGGG - Intronic
1021844040 7:24746760-24746782 TGTCAACTGCTGTTGGTGGAAGG + Intronic
1024117473 7:46207531-46207553 CATCGCATGCTGAGGGTGGAAGG - Intergenic
1027229707 7:76265080-76265102 GATCACCTGCTGAGGGCTGAGGG + Intronic
1031492902 7:122411119-122411141 TCTGATCTGCTGATGGTAGATGG - Intronic
1031927513 7:127652247-127652269 TACCAGCTGCGGACGGTGGACGG - Exonic
1032702279 7:134392834-134392856 TATCATCTGCTCAGAATGTAGGG + Intergenic
1034732545 7:153400530-153400552 TTTCAGCTCCTGAGTGTGGAAGG - Intergenic
1035281504 7:157781257-157781279 TATCATCTCCTCAAAGTGGAGGG + Intronic
1035344137 7:158187421-158187443 TTTCATCAGCTGAGAGGGGAGGG + Intronic
1036674559 8:10819132-10819154 TTCCATCTGCTGAGGGTGCAGGG + Intronic
1037049450 8:14352255-14352277 TATCAGCTACTGAGTGAGGAAGG + Intronic
1038150594 8:24939935-24939957 TTTAATCTGCTGAAGGTGGGGGG - Intergenic
1041164200 8:55074641-55074663 TATCAACCGCTCAGGGTGCAAGG - Intergenic
1041252307 8:55946232-55946254 TATCACTTGCTGTGGGTGGCAGG - Intronic
1043463634 8:80485767-80485789 TGTCATTTGCTGAGGGTGGGTGG - Exonic
1044441650 8:92230922-92230944 CAGCATCTGCGGAGGGTGCACGG + Intergenic
1044580007 8:93815758-93815780 TAACGTCTGGAGAGGGTGGATGG - Intronic
1045235297 8:100347405-100347427 TCACAACTACTGAGGGTGGAGGG - Intronic
1045379879 8:101612449-101612471 TAGCATCTTCAGAGTGTGGATGG + Intronic
1046028875 8:108759281-108759303 TTTCATCTGCTATTGGTGGAAGG + Intronic
1047181875 8:122596181-122596203 TATATGCTGCTGAGGTTGGATGG + Intergenic
1049699804 8:144005252-144005274 GATGAGCTGCTGAAGGTGGATGG + Intronic
1049783718 8:144440578-144440600 TCCCAGCTGCCGAGGGTGGATGG + Intronic
1051600165 9:18864591-18864613 CATCTTCTGCTGAGGGTGCGAGG + Intronic
1052301745 9:26959735-26959757 AGTCATCTGCTGAGAGTGGCAGG + Intronic
1052801609 9:32973274-32973296 TATTCTCTGGTGAGGGTGGCTGG - Exonic
1054932764 9:70653277-70653299 TACCATCTGCTGAAGGTGAGAGG + Intronic
1055717337 9:79132288-79132310 TTTCTTTTGCTGAAGGTGGAAGG - Intergenic
1057620020 9:96626534-96626556 CATCATCTGCAAAGGGTGAAGGG - Intergenic
1060211744 9:121714797-121714819 TTTCATCTGGTGGGGGTGGTGGG + Intronic
1060429425 9:123536624-123536646 TAGCATTTGCGGAGGCTGGACGG - Intronic
1062736005 9:138137733-138137755 CTTCATCAGGTGAGGGTGGAGGG + Intergenic
1185820517 X:3198589-3198611 AATCCTCTGTTGAGGGTTGATGG + Intergenic
1186360477 X:8836114-8836136 TTTCATCTGCTGAGGGTAAGTGG - Intergenic
1188513854 X:30964392-30964414 TATCATATGGTGCAGGTGGAGGG - Intronic
1188882701 X:35509645-35509667 TCTCATCTACTGAAGGTGAAAGG + Intergenic
1192220904 X:69196741-69196763 TGCCATCTGCTGAGGGGGTAGGG + Intergenic
1194073082 X:89351221-89351243 GATAATTTGCTGAGAGTGGATGG - Intergenic
1195392916 X:104381745-104381767 AATCATCTGCTGAAAGTGTAAGG - Intergenic
1196463260 X:115950274-115950296 TTTCCTCTGCAAAGGGTGGAGGG - Intergenic
1196787482 X:119433661-119433683 TAACATCTGATGAGTTTGGAAGG + Intronic
1198192366 X:134320850-134320872 TATCAGGTGCTGGGGGTGGGAGG + Intergenic
1200705913 Y:6442322-6442344 TACAATCTGGTCAGGGTGGATGG - Intergenic
1200727317 Y:6686961-6686983 GATAATTTGCTGAGAGTGGATGG - Intergenic
1200728469 Y:6702736-6702758 GATAATTTGCTGAGAGTGGATGG - Intergenic
1201028197 Y:9722386-9722408 TACAATCTGGTCAGGGTGGATGG + Intergenic
1201337678 Y:12897828-12897850 TATGATGTGGTGAGGGTGGAAGG + Intergenic