ID: 1135451850

View in Genome Browser
Species Human (GRCh38)
Location 16:22565351-22565373
Sequence CATTAAACGGAGATGGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135451841_1135451850 13 Left 1135451841 16:22565315-22565337 CCTTAATGATCTATATTGTGTGA No data
Right 1135451850 16:22565351-22565373 CATTAAACGGAGATGGGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135451850 Original CRISPR CATTAAACGGAGATGGGGGC CGG Intergenic
No off target data available for this crispr