ID: 1135452677

View in Genome Browser
Species Human (GRCh38)
Location 16:22572110-22572132
Sequence CAGGAGCCTGAACTGTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135452668_1135452677 30 Left 1135452668 16:22572057-22572079 CCTGGAGTGAAGAATGCCATGTG No data
Right 1135452677 16:22572110-22572132 CAGGAGCCTGAACTGTGTTCTGG No data
1135452672_1135452677 14 Left 1135452672 16:22572073-22572095 CCATGTGTGAGGCTGGAGAGGTG No data
Right 1135452677 16:22572110-22572132 CAGGAGCCTGAACTGTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135452677 Original CRISPR CAGGAGCCTGAACTGTGTTC TGG Intergenic
No off target data available for this crispr