ID: 1135457369

View in Genome Browser
Species Human (GRCh38)
Location 16:22609973-22609995
Sequence GCACCACCCCAACATCACAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135457369_1135457377 26 Left 1135457369 16:22609973-22609995 CCCGTGTGATGTTGGGGTGGTGC No data
Right 1135457377 16:22610022-22610044 AGCCAGATGCTCTGTCATGAGGG No data
1135457369_1135457376 25 Left 1135457369 16:22609973-22609995 CCCGTGTGATGTTGGGGTGGTGC No data
Right 1135457376 16:22610021-22610043 CAGCCAGATGCTCTGTCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135457369 Original CRISPR GCACCACCCCAACATCACAC GGG (reversed) Intergenic
No off target data available for this crispr