ID: 1135457372

View in Genome Browser
Species Human (GRCh38)
Location 16:22610007-22610029
Sequence ATCTGGCTGGTGACGGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135457372_1135457386 21 Left 1135457372 16:22610007-22610029 CCTTTTCCCGTCACCAGCCAGAT No data
Right 1135457386 16:22610051-22610073 GAAGGAAGGAAGAAGGGGAAGGG No data
1135457372_1135457385 20 Left 1135457372 16:22610007-22610029 CCTTTTCCCGTCACCAGCCAGAT No data
Right 1135457385 16:22610050-22610072 GGAAGGAAGGAAGAAGGGGAAGG No data
1135457372_1135457384 16 Left 1135457372 16:22610007-22610029 CCTTTTCCCGTCACCAGCCAGAT No data
Right 1135457384 16:22610046-22610068 GACTGGAAGGAAGGAAGAAGGGG No data
1135457372_1135457383 15 Left 1135457372 16:22610007-22610029 CCTTTTCCCGTCACCAGCCAGAT No data
Right 1135457383 16:22610045-22610067 AGACTGGAAGGAAGGAAGAAGGG No data
1135457372_1135457379 -1 Left 1135457372 16:22610007-22610029 CCTTTTCCCGTCACCAGCCAGAT No data
Right 1135457379 16:22610029-22610051 TGCTCTGTCATGAGGGAGACTGG No data
1135457372_1135457382 14 Left 1135457372 16:22610007-22610029 CCTTTTCCCGTCACCAGCCAGAT No data
Right 1135457382 16:22610044-22610066 GAGACTGGAAGGAAGGAAGAAGG No data
1135457372_1135457377 -8 Left 1135457372 16:22610007-22610029 CCTTTTCCCGTCACCAGCCAGAT No data
Right 1135457377 16:22610022-22610044 AGCCAGATGCTCTGTCATGAGGG No data
1135457372_1135457376 -9 Left 1135457372 16:22610007-22610029 CCTTTTCCCGTCACCAGCCAGAT No data
Right 1135457376 16:22610021-22610043 CAGCCAGATGCTCTGTCATGAGG No data
1135457372_1135457381 7 Left 1135457372 16:22610007-22610029 CCTTTTCCCGTCACCAGCCAGAT No data
Right 1135457381 16:22610037-22610059 CATGAGGGAGACTGGAAGGAAGG No data
1135457372_1135457380 3 Left 1135457372 16:22610007-22610029 CCTTTTCCCGTCACCAGCCAGAT No data
Right 1135457380 16:22610033-22610055 CTGTCATGAGGGAGACTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135457372 Original CRISPR ATCTGGCTGGTGACGGGAAA AGG (reversed) Intergenic