ID: 1135457374

View in Genome Browser
Species Human (GRCh38)
Location 16:22610014-22610036
Sequence ACAGAGCATCTGGCTGGTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135457374_1135457386 14 Left 1135457374 16:22610014-22610036 CCGTCACCAGCCAGATGCTCTGT No data
Right 1135457386 16:22610051-22610073 GAAGGAAGGAAGAAGGGGAAGGG No data
1135457374_1135457382 7 Left 1135457374 16:22610014-22610036 CCGTCACCAGCCAGATGCTCTGT No data
Right 1135457382 16:22610044-22610066 GAGACTGGAAGGAAGGAAGAAGG No data
1135457374_1135457380 -4 Left 1135457374 16:22610014-22610036 CCGTCACCAGCCAGATGCTCTGT No data
Right 1135457380 16:22610033-22610055 CTGTCATGAGGGAGACTGGAAGG No data
1135457374_1135457383 8 Left 1135457374 16:22610014-22610036 CCGTCACCAGCCAGATGCTCTGT No data
Right 1135457383 16:22610045-22610067 AGACTGGAAGGAAGGAAGAAGGG No data
1135457374_1135457385 13 Left 1135457374 16:22610014-22610036 CCGTCACCAGCCAGATGCTCTGT No data
Right 1135457385 16:22610050-22610072 GGAAGGAAGGAAGAAGGGGAAGG No data
1135457374_1135457384 9 Left 1135457374 16:22610014-22610036 CCGTCACCAGCCAGATGCTCTGT No data
Right 1135457384 16:22610046-22610068 GACTGGAAGGAAGGAAGAAGGGG No data
1135457374_1135457379 -8 Left 1135457374 16:22610014-22610036 CCGTCACCAGCCAGATGCTCTGT No data
Right 1135457379 16:22610029-22610051 TGCTCTGTCATGAGGGAGACTGG No data
1135457374_1135457381 0 Left 1135457374 16:22610014-22610036 CCGTCACCAGCCAGATGCTCTGT No data
Right 1135457381 16:22610037-22610059 CATGAGGGAGACTGGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135457374 Original CRISPR ACAGAGCATCTGGCTGGTGA CGG (reversed) Intergenic