ID: 1135457376

View in Genome Browser
Species Human (GRCh38)
Location 16:22610021-22610043
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135457369_1135457376 25 Left 1135457369 16:22609973-22609995 CCCGTGTGATGTTGGGGTGGTGC No data
Right 1135457376 16:22610021-22610043 CAGCCAGATGCTCTGTCATGAGG No data
1135457372_1135457376 -9 Left 1135457372 16:22610007-22610029 CCTTTTCCCGTCACCAGCCAGAT No data
Right 1135457376 16:22610021-22610043 CAGCCAGATGCTCTGTCATGAGG No data
1135457370_1135457376 24 Left 1135457370 16:22609974-22609996 CCGTGTGATGTTGGGGTGGTGCT No data
Right 1135457376 16:22610021-22610043 CAGCCAGATGCTCTGTCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135457376 Original CRISPR CAGCCAGATGCTCTGTCATG AGG Intergenic