ID: 1135457379

View in Genome Browser
Species Human (GRCh38)
Location 16:22610029-22610051
Sequence TGCTCTGTCATGAGGGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135457374_1135457379 -8 Left 1135457374 16:22610014-22610036 CCGTCACCAGCCAGATGCTCTGT No data
Right 1135457379 16:22610029-22610051 TGCTCTGTCATGAGGGAGACTGG No data
1135457372_1135457379 -1 Left 1135457372 16:22610007-22610029 CCTTTTCCCGTCACCAGCCAGAT No data
Right 1135457379 16:22610029-22610051 TGCTCTGTCATGAGGGAGACTGG No data
1135457373_1135457379 -7 Left 1135457373 16:22610013-22610035 CCCGTCACCAGCCAGATGCTCTG No data
Right 1135457379 16:22610029-22610051 TGCTCTGTCATGAGGGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135457379 Original CRISPR TGCTCTGTCATGAGGGAGAC TGG Intergenic
No off target data available for this crispr