ID: 1135457382

View in Genome Browser
Species Human (GRCh38)
Location 16:22610044-22610066
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135457373_1135457382 8 Left 1135457373 16:22610013-22610035 CCCGTCACCAGCCAGATGCTCTG No data
Right 1135457382 16:22610044-22610066 GAGACTGGAAGGAAGGAAGAAGG No data
1135457374_1135457382 7 Left 1135457374 16:22610014-22610036 CCGTCACCAGCCAGATGCTCTGT No data
Right 1135457382 16:22610044-22610066 GAGACTGGAAGGAAGGAAGAAGG No data
1135457375_1135457382 1 Left 1135457375 16:22610020-22610042 CCAGCCAGATGCTCTGTCATGAG No data
Right 1135457382 16:22610044-22610066 GAGACTGGAAGGAAGGAAGAAGG No data
1135457372_1135457382 14 Left 1135457372 16:22610007-22610029 CCTTTTCCCGTCACCAGCCAGAT No data
Right 1135457382 16:22610044-22610066 GAGACTGGAAGGAAGGAAGAAGG No data
1135457378_1135457382 -3 Left 1135457378 16:22610024-22610046 CCAGATGCTCTGTCATGAGGGAG No data
Right 1135457382 16:22610044-22610066 GAGACTGGAAGGAAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135457382 Original CRISPR GAGACTGGAAGGAAGGAAGA AGG Intergenic