ID: 1135457385

View in Genome Browser
Species Human (GRCh38)
Location 16:22610050-22610072
Sequence GGAAGGAAGGAAGAAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30195
Summary {0: 8, 1: 137, 2: 2010, 3: 8991, 4: 19049}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135457378_1135457385 3 Left 1135457378 16:22610024-22610046 CCAGATGCTCTGTCATGAGGGAG No data
Right 1135457385 16:22610050-22610072 GGAAGGAAGGAAGAAGGGGAAGG 0: 8
1: 137
2: 2010
3: 8991
4: 19049
1135457375_1135457385 7 Left 1135457375 16:22610020-22610042 CCAGCCAGATGCTCTGTCATGAG No data
Right 1135457385 16:22610050-22610072 GGAAGGAAGGAAGAAGGGGAAGG 0: 8
1: 137
2: 2010
3: 8991
4: 19049
1135457373_1135457385 14 Left 1135457373 16:22610013-22610035 CCCGTCACCAGCCAGATGCTCTG No data
Right 1135457385 16:22610050-22610072 GGAAGGAAGGAAGAAGGGGAAGG 0: 8
1: 137
2: 2010
3: 8991
4: 19049
1135457374_1135457385 13 Left 1135457374 16:22610014-22610036 CCGTCACCAGCCAGATGCTCTGT No data
Right 1135457385 16:22610050-22610072 GGAAGGAAGGAAGAAGGGGAAGG 0: 8
1: 137
2: 2010
3: 8991
4: 19049
1135457372_1135457385 20 Left 1135457372 16:22610007-22610029 CCTTTTCCCGTCACCAGCCAGAT No data
Right 1135457385 16:22610050-22610072 GGAAGGAAGGAAGAAGGGGAAGG 0: 8
1: 137
2: 2010
3: 8991
4: 19049

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135457385 Original CRISPR GGAAGGAAGGAAGAAGGGGA AGG Intergenic
Too many off-targets to display for this crispr