ID: 1135459033

View in Genome Browser
Species Human (GRCh38)
Location 16:22625201-22625223
Sequence AAGGAAATGAAAGGGGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135459033_1135459042 21 Left 1135459033 16:22625201-22625223 CCCCCAGCCCCTTTCATTTCCTT No data
Right 1135459042 16:22625245-22625267 TCACCCAGGCTAGAATGCAGTGG 0: 362
1: 10697
2: 104002
3: 189232
4: 208189
1135459033_1135459041 7 Left 1135459033 16:22625201-22625223 CCCCCAGCCCCTTTCATTTCCTT No data
Right 1135459041 16:22625231-22625253 AAAGTCTTGCTCTGTCACCCAGG 0: 509
1: 12855
2: 48612
3: 106174
4: 160868

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135459033 Original CRISPR AAGGAAATGAAAGGGGCTGG GGG (reversed) Intergenic
No off target data available for this crispr