ID: 1135459907

View in Genome Browser
Species Human (GRCh38)
Location 16:22633208-22633230
Sequence GCCCAGCTACAGGGAGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135459907_1135459915 30 Left 1135459907 16:22633208-22633230 CCTCAGCCTCCCTGTAGCTGGGC No data
Right 1135459915 16:22633261-22633283 TTTTTTATGTTTTGTAGAGATGG 0: 47
1: 1473
2: 18829
3: 246199
4: 258253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135459907 Original CRISPR GCCCAGCTACAGGGAGGCTG AGG (reversed) Intergenic
No off target data available for this crispr