ID: 1135459908

View in Genome Browser
Species Human (GRCh38)
Location 16:22633214-22633236
Sequence CTGTAGGCCCAGCTACAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135459908_1135459917 26 Left 1135459908 16:22633214-22633236 CCTCCCTGTAGCTGGGCCTACAG No data
Right 1135459917 16:22633263-22633285 TTTTATGTTTTGTAGAGATGGGG 0: 54
1: 1872
2: 13795
3: 121984
4: 221363
1135459908_1135459916 25 Left 1135459908 16:22633214-22633236 CCTCCCTGTAGCTGGGCCTACAG No data
Right 1135459916 16:22633262-22633284 TTTTTATGTTTTGTAGAGATGGG 0: 51
1: 1561
2: 15057
3: 134247
4: 299474
1135459908_1135459915 24 Left 1135459908 16:22633214-22633236 CCTCCCTGTAGCTGGGCCTACAG No data
Right 1135459915 16:22633261-22633283 TTTTTTATGTTTTGTAGAGATGG 0: 47
1: 1473
2: 18829
3: 246199
4: 258253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135459908 Original CRISPR CTGTAGGCCCAGCTACAGGG AGG (reversed) Intergenic
No off target data available for this crispr