ID: 1135459914

View in Genome Browser
Species Human (GRCh38)
Location 16:22633247-22633269
Sequence CATAAAAAATTAGCTAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135459914_1135459916 -8 Left 1135459914 16:22633247-22633269 CCATGCTTAGCTAATTTTTTATG No data
Right 1135459916 16:22633262-22633284 TTTTTATGTTTTGTAGAGATGGG 0: 51
1: 1561
2: 15057
3: 134247
4: 299474
1135459914_1135459919 19 Left 1135459914 16:22633247-22633269 CCATGCTTAGCTAATTTTTTATG No data
Right 1135459919 16:22633289-22633311 TCTTGCTATGTTGCCCAGGCTGG 0: 5370
1: 36977
2: 98936
3: 206535
4: 250422
1135459914_1135459917 -7 Left 1135459914 16:22633247-22633269 CCATGCTTAGCTAATTTTTTATG No data
Right 1135459917 16:22633263-22633285 TTTTATGTTTTGTAGAGATGGGG 0: 54
1: 1872
2: 13795
3: 121984
4: 221363
1135459914_1135459918 15 Left 1135459914 16:22633247-22633269 CCATGCTTAGCTAATTTTTTATG No data
Right 1135459918 16:22633285-22633307 GATGTCTTGCTATGTTGCCCAGG 0: 27
1: 1058
2: 6892
3: 31520
4: 90769
1135459914_1135459915 -9 Left 1135459914 16:22633247-22633269 CCATGCTTAGCTAATTTTTTATG No data
Right 1135459915 16:22633261-22633283 TTTTTTATGTTTTGTAGAGATGG 0: 47
1: 1473
2: 18829
3: 246199
4: 258253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135459914 Original CRISPR CATAAAAAATTAGCTAAGCA TGG (reversed) Intergenic
No off target data available for this crispr