ID: 1135459915

View in Genome Browser
Species Human (GRCh38)
Location 16:22633261-22633283
Sequence TTTTTTATGTTTTGTAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 524801
Summary {0: 47, 1: 1473, 2: 18829, 3: 246199, 4: 258253}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135459910_1135459915 21 Left 1135459910 16:22633217-22633239 CCCTGTAGCTGGGCCTACAGGCA No data
Right 1135459915 16:22633261-22633283 TTTTTTATGTTTTGTAGAGATGG 0: 47
1: 1473
2: 18829
3: 246199
4: 258253
1135459914_1135459915 -9 Left 1135459914 16:22633247-22633269 CCATGCTTAGCTAATTTTTTATG No data
Right 1135459915 16:22633261-22633283 TTTTTTATGTTTTGTAGAGATGG 0: 47
1: 1473
2: 18829
3: 246199
4: 258253
1135459908_1135459915 24 Left 1135459908 16:22633214-22633236 CCTCCCTGTAGCTGGGCCTACAG No data
Right 1135459915 16:22633261-22633283 TTTTTTATGTTTTGTAGAGATGG 0: 47
1: 1473
2: 18829
3: 246199
4: 258253
1135459911_1135459915 20 Left 1135459911 16:22633218-22633240 CCTGTAGCTGGGCCTACAGGCAC 0: 9
1: 1091
2: 4833
3: 7693
4: 7648
Right 1135459915 16:22633261-22633283 TTTTTTATGTTTTGTAGAGATGG 0: 47
1: 1473
2: 18829
3: 246199
4: 258253
1135459907_1135459915 30 Left 1135459907 16:22633208-22633230 CCTCAGCCTCCCTGTAGCTGGGC No data
Right 1135459915 16:22633261-22633283 TTTTTTATGTTTTGTAGAGATGG 0: 47
1: 1473
2: 18829
3: 246199
4: 258253
1135459913_1135459915 -4 Left 1135459913 16:22633242-22633264 CCTCACCATGCTTAGCTAATTTT No data
Right 1135459915 16:22633261-22633283 TTTTTTATGTTTTGTAGAGATGG 0: 47
1: 1473
2: 18829
3: 246199
4: 258253
1135459912_1135459915 8 Left 1135459912 16:22633230-22633252 CCTACAGGCACACCTCACCATGC No data
Right 1135459915 16:22633261-22633283 TTTTTTATGTTTTGTAGAGATGG 0: 47
1: 1473
2: 18829
3: 246199
4: 258253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135459915 Original CRISPR TTTTTTATGTTTTGTAGAGA TGG Intergenic
Too many off-targets to display for this crispr