ID: 1135459917

View in Genome Browser
Species Human (GRCh38)
Location 16:22633263-22633285
Sequence TTTTATGTTTTGTAGAGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 359068
Summary {0: 54, 1: 1872, 2: 13795, 3: 121984, 4: 221363}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135459908_1135459917 26 Left 1135459908 16:22633214-22633236 CCTCCCTGTAGCTGGGCCTACAG No data
Right 1135459917 16:22633263-22633285 TTTTATGTTTTGTAGAGATGGGG 0: 54
1: 1872
2: 13795
3: 121984
4: 221363
1135459912_1135459917 10 Left 1135459912 16:22633230-22633252 CCTACAGGCACACCTCACCATGC No data
Right 1135459917 16:22633263-22633285 TTTTATGTTTTGTAGAGATGGGG 0: 54
1: 1872
2: 13795
3: 121984
4: 221363
1135459914_1135459917 -7 Left 1135459914 16:22633247-22633269 CCATGCTTAGCTAATTTTTTATG No data
Right 1135459917 16:22633263-22633285 TTTTATGTTTTGTAGAGATGGGG 0: 54
1: 1872
2: 13795
3: 121984
4: 221363
1135459913_1135459917 -2 Left 1135459913 16:22633242-22633264 CCTCACCATGCTTAGCTAATTTT No data
Right 1135459917 16:22633263-22633285 TTTTATGTTTTGTAGAGATGGGG 0: 54
1: 1872
2: 13795
3: 121984
4: 221363
1135459910_1135459917 23 Left 1135459910 16:22633217-22633239 CCCTGTAGCTGGGCCTACAGGCA No data
Right 1135459917 16:22633263-22633285 TTTTATGTTTTGTAGAGATGGGG 0: 54
1: 1872
2: 13795
3: 121984
4: 221363
1135459911_1135459917 22 Left 1135459911 16:22633218-22633240 CCTGTAGCTGGGCCTACAGGCAC 0: 9
1: 1091
2: 4833
3: 7693
4: 7648
Right 1135459917 16:22633263-22633285 TTTTATGTTTTGTAGAGATGGGG 0: 54
1: 1872
2: 13795
3: 121984
4: 221363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135459917 Original CRISPR TTTTATGTTTTGTAGAGATG GGG Intergenic
Too many off-targets to display for this crispr