ID: 1135464874

View in Genome Browser
Species Human (GRCh38)
Location 16:22676650-22676672
Sequence AAATATCCCCAATTGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135464869_1135464874 -8 Left 1135464869 16:22676635-22676657 CCGGGCATTATTGCCAAATATCC No data
Right 1135464874 16:22676650-22676672 AAATATCCCCAATTGGAGGTGGG No data
1135464864_1135464874 18 Left 1135464864 16:22676609-22676631 CCTGCTTGTGACCACCAAAAATG No data
Right 1135464874 16:22676650-22676672 AAATATCCCCAATTGGAGGTGGG No data
1135464868_1135464874 4 Left 1135464868 16:22676623-22676645 CCAAAAATGTCTCCGGGCATTAT No data
Right 1135464874 16:22676650-22676672 AAATATCCCCAATTGGAGGTGGG No data
1135464863_1135464874 19 Left 1135464863 16:22676608-22676630 CCCTGCTTGTGACCACCAAAAAT No data
Right 1135464874 16:22676650-22676672 AAATATCCCCAATTGGAGGTGGG No data
1135464867_1135464874 7 Left 1135464867 16:22676620-22676642 CCACCAAAAATGTCTCCGGGCAT No data
Right 1135464874 16:22676650-22676672 AAATATCCCCAATTGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135464874 Original CRISPR AAATATCCCCAATTGGAGGT GGG Intergenic
No off target data available for this crispr