ID: 1135464883

View in Genome Browser
Species Human (GRCh38)
Location 16:22676688-22676710
Sequence CTAATTCAGTGGTTCTCAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135464883_1135464887 -8 Left 1135464883 16:22676688-22676710 CCGACTGAGAACCACTGAATTAG No data
Right 1135464887 16:22676703-22676725 TGAATTAGAAAAATCAGGCAGGG No data
1135464883_1135464889 8 Left 1135464883 16:22676688-22676710 CCGACTGAGAACCACTGAATTAG No data
Right 1135464889 16:22676719-22676741 GGCAGGGATCCTATCGAAAAGGG No data
1135464883_1135464886 -9 Left 1135464883 16:22676688-22676710 CCGACTGAGAACCACTGAATTAG No data
Right 1135464886 16:22676702-22676724 CTGAATTAGAAAAATCAGGCAGG No data
1135464883_1135464888 7 Left 1135464883 16:22676688-22676710 CCGACTGAGAACCACTGAATTAG No data
Right 1135464888 16:22676718-22676740 AGGCAGGGATCCTATCGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135464883 Original CRISPR CTAATTCAGTGGTTCTCAGT CGG (reversed) Intergenic
No off target data available for this crispr