ID: 1135465528

View in Genome Browser
Species Human (GRCh38)
Location 16:22681568-22681590
Sequence AATGCTCGCCTGCTGCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135465526_1135465528 17 Left 1135465526 16:22681528-22681550 CCATGATTTACAAAGGCAGCAGC No data
Right 1135465528 16:22681568-22681590 AATGCTCGCCTGCTGCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135465528 Original CRISPR AATGCTCGCCTGCTGCTGGC TGG Intergenic
No off target data available for this crispr