ID: 1135465604

View in Genome Browser
Species Human (GRCh38)
Location 16:22682033-22682055
Sequence CCTCGAGGGCAAGGCCTAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135465591_1135465604 24 Left 1135465591 16:22681986-22682008 CCCTCCTTTCCATAATGGATGTG No data
Right 1135465604 16:22682033-22682055 CCTCGAGGGCAAGGCCTAGGCGG No data
1135465592_1135465604 23 Left 1135465592 16:22681987-22682009 CCTCCTTTCCATAATGGATGTGT No data
Right 1135465604 16:22682033-22682055 CCTCGAGGGCAAGGCCTAGGCGG No data
1135465594_1135465604 20 Left 1135465594 16:22681990-22682012 CCTTTCCATAATGGATGTGTGGT No data
Right 1135465604 16:22682033-22682055 CCTCGAGGGCAAGGCCTAGGCGG No data
1135465595_1135465604 15 Left 1135465595 16:22681995-22682017 CCATAATGGATGTGTGGTTGAAC No data
Right 1135465604 16:22682033-22682055 CCTCGAGGGCAAGGCCTAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135465604 Original CRISPR CCTCGAGGGCAAGGCCTAGG CGG Intergenic
No off target data available for this crispr