ID: 1135468657

View in Genome Browser
Species Human (GRCh38)
Location 16:22709531-22709553
Sequence AGTCTGAGAGGGCCAGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135468657_1135468661 9 Left 1135468657 16:22709531-22709553 CCCAGTTCTGGCCCTCTCAGACT No data
Right 1135468661 16:22709563-22709585 TGCAACAGCCATTTTCTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135468657 Original CRISPR AGTCTGAGAGGGCCAGAACT GGG (reversed) Intergenic
No off target data available for this crispr