ID: 1135476152

View in Genome Browser
Species Human (GRCh38)
Location 16:22777423-22777445
Sequence AAAAGGATATTGAACACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135476150_1135476152 -5 Left 1135476150 16:22777405-22777427 CCAGGGATGTGTTTTCGTAAAAG No data
Right 1135476152 16:22777423-22777445 AAAAGGATATTGAACACAGAAGG No data
1135476149_1135476152 -4 Left 1135476149 16:22777404-22777426 CCCAGGGATGTGTTTTCGTAAAA No data
Right 1135476152 16:22777423-22777445 AAAAGGATATTGAACACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135476152 Original CRISPR AAAAGGATATTGAACACAGA AGG Intergenic
No off target data available for this crispr