ID: 1135477594

View in Genome Browser
Species Human (GRCh38)
Location 16:22790453-22790475
Sequence TAACATAACCATTATGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135477590_1135477594 9 Left 1135477590 16:22790421-22790443 CCTTCAAATACACGCTGAAATAG No data
Right 1135477594 16:22790453-22790475 TAACATAACCATTATGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135477594 Original CRISPR TAACATAACCATTATGGGTT GGG Intergenic
No off target data available for this crispr