ID: 1135481069

View in Genome Browser
Species Human (GRCh38)
Location 16:22821039-22821061
Sequence CTGGCTACAGAGATGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135481069_1135481074 -3 Left 1135481069 16:22821039-22821061 CCCTGCTTCATCTCTGTAGCCAG No data
Right 1135481074 16:22821059-22821081 CAGCAGGGCTCTCTTCTGATTGG No data
1135481069_1135481075 2 Left 1135481069 16:22821039-22821061 CCCTGCTTCATCTCTGTAGCCAG No data
Right 1135481075 16:22821064-22821086 GGGCTCTCTTCTGATTGGTCCGG No data
1135481069_1135481077 9 Left 1135481069 16:22821039-22821061 CCCTGCTTCATCTCTGTAGCCAG No data
Right 1135481077 16:22821071-22821093 CTTCTGATTGGTCCGGGAGCTGG No data
1135481069_1135481076 3 Left 1135481069 16:22821039-22821061 CCCTGCTTCATCTCTGTAGCCAG No data
Right 1135481076 16:22821065-22821087 GGCTCTCTTCTGATTGGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135481069 Original CRISPR CTGGCTACAGAGATGAAGCA GGG (reversed) Intronic
No off target data available for this crispr