ID: 1135481076

View in Genome Browser
Species Human (GRCh38)
Location 16:22821065-22821087
Sequence GGCTCTCTTCTGATTGGTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135481066_1135481076 27 Left 1135481066 16:22821015-22821037 CCTTCCAAAGAGCCAGTGACTAG No data
Right 1135481076 16:22821065-22821087 GGCTCTCTTCTGATTGGTCCGGG No data
1135481069_1135481076 3 Left 1135481069 16:22821039-22821061 CCCTGCTTCATCTCTGTAGCCAG No data
Right 1135481076 16:22821065-22821087 GGCTCTCTTCTGATTGGTCCGGG No data
1135481068_1135481076 15 Left 1135481068 16:22821027-22821049 CCAGTGACTAGACCCTGCTTCAT No data
Right 1135481076 16:22821065-22821087 GGCTCTCTTCTGATTGGTCCGGG No data
1135481070_1135481076 2 Left 1135481070 16:22821040-22821062 CCTGCTTCATCTCTGTAGCCAGC No data
Right 1135481076 16:22821065-22821087 GGCTCTCTTCTGATTGGTCCGGG No data
1135481067_1135481076 23 Left 1135481067 16:22821019-22821041 CCAAAGAGCCAGTGACTAGACCC No data
Right 1135481076 16:22821065-22821087 GGCTCTCTTCTGATTGGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135481076 Original CRISPR GGCTCTCTTCTGATTGGTCC GGG Intronic
No off target data available for this crispr